RchiOBHm_Chr2g0115591

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001798
Physical Location & Seq
Forward (+)
27760529 .. 27767123
6595 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48875

Sequence Viewer

Length: 171 bp
ATGCAGCCTTGGGTAGACCATATTATTAGAGCGAAGAATATGATGGTAGCTCAGGAGATCATCGAGCTATTTGCTGAGCTTATTTATATTCGCAGATTGAGGTCTGCTGTTCTTCTGCTGATTACTTCTTCTAAATATATTGCAAAGAAACTGGGGCCTTGTGTGCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.51

Weight (kDa)

9.74

Isoelectric Point (pI)

50.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 15
AluBI AGCT 3 cut(s) 50, 67, 79
AluI AGCT 3 cut(s) 50, 67, 79
AoxI GGCC 1 cut(s) 155
ApeKI GCWGC 1 cut(s) 4
AspS9I GGNCC 1 cut(s) 155
BbvI GCAGC 1 cut(s) 16
BccI CCATC 1 cut(s) 37
BcgI CGANNNNNNTGC 2 cut(s) 53, 87
BisI GCNGC 1 cut(s) 5
BlpI GCTNAGC 1 cut(s) 75
BlsI GCNGC 1 cut(s) 6
BmgT120I GGNCC 1 cut(s) 155
BmiI GGNNCC 1 cut(s) 156
BmrI ACTGGG 1 cut(s) 161
BmuI ACTGGG 1 cut(s) 161
Bpu10I CCTNAGC 1 cut(s) 51
Bpu1102I GCTNAGC 1 cut(s) 75
BsaJI CCNNGG 1 cut(s) 8
Bse1I ACTGG 1 cut(s) 156
BseDI CCNNGG 1 cut(s) 8
BseMII CTCAG 2 cut(s) 65, 66
BseNI ACTGG 1 cut(s) 156
BseXI GCAGC 1 cut(s) 16
BshFI GGCC 1 cut(s) 157
BsnI GGCC 1 cut(s) 157
Bsp143I GATC 1 cut(s) 57
Bsp1720I GCTNAGC 1 cut(s) 75
BspANI GGCC 1 cut(s) 157
BspCNI CTCAG 2 cut(s) 64, 67
BspLI GGNNCC 1 cut(s) 156
BsrI ACTGG 1 cut(s) 156
BssECI CCNNGG 1 cut(s) 8
BssMI GATC 1 cut(s) 57
BssT1I CCWWGG 1 cut(s) 8
BstDEI CTNAG 2 cut(s) 51, 75
BstKTI GATC 1 cut(s) 60
BstMBI GATC 1 cut(s) 57
BstMWI GCNNNNNNNGC 1 cut(s) 163
BstV1I GCAGC 1 cut(s) 16
BsuRI GGCC 1 cut(s) 157
Cfr13I GGNCC 1 cut(s) 155
CviJI RGCY 5 cut(s) 7, 50, 67, 79, 157
CviKI_1 RGCY 5 cut(s) 7, 50, 67, 79, 157
DdeI CTNAG 2 cut(s) 51, 75
DpnI GATC 1 cut(s) 59
DpnII GATC 1 cut(s) 57
Eco130I CCWWGG 1 cut(s) 8
EcoO109I RGGNCCY 1 cut(s) 155
EcoT14I CCWWGG 1 cut(s) 8
ErhI CCWWGG 1 cut(s) 8
FaiI YATR 4 cut(s) 21, 41, 87, 138
FblI GTMKAC 1 cut(s) 15
Fnu4HI GCNGC 1 cut(s) 5
Fsp4HI GCNGC 1 cut(s) 5
FspEI CC 8 cut(s) 21, 29, 32, 38, 85, 137, 138, 139
GluI GCNGC 1 cut(s) 5
HaeIII GGCC 1 cut(s) 157
Hpy166II GTNNAC 1 cut(s) 16
Hpy188III TCNNGA 1 cut(s) 53
Hpy8I GTNNAC 1 cut(s) 16
HpyCH4V TGCA 3 cut(s) 4, 143, 166
HpyF10VI GCNNNNNNNGC 1 cut(s) 163
HpyF3I CTNAG 2 cut(s) 51, 75
Kzo9I GATC 1 cut(s) 57
LpnPI CCDG 2 cut(s) 38, 137
Lsp1109I GCAGC 1 cut(s) 16
MalI GATC 1 cut(s) 59
MboI GATC 1 cut(s) 57
MboII GAAGA 3 cut(s) 46, 104, 120
MnlI CCTC 1 cut(s) 93
MwoI GCNNNNNNNGC 1 cut(s) 163
NdeII GATC 1 cut(s) 57
NlaIV GGNNCC 1 cut(s) 156
PkrI GCNGC 1 cut(s) 6
PspN4I GGNNCC 1 cut(s) 156
PspPI GGNCC 1 cut(s) 155
SatI GCNGC 1 cut(s) 5
Sau3AI GATC 1 cut(s) 57
Sau96I GGNCC 1 cut(s) 155
SetI ASST 4 cut(s) 52, 69, 81, 104
SgeI CNNG 4 cut(s) 21, 65, 76, 164
StyI CCWWGG 1 cut(s) 8
TaqI TCGA 1 cut(s) 63
TseI GCWGC 1 cut(s) 4
XmiI GTMKAC 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.