Rh5AG529000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
90708191 .. 90719880
11690 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG529000.1

Sequence Viewer

Length: 183 bp
ATGGAGCTTGACTTGTCGAATAAGACAGCAGAAATGCAAGGGTCTACTACAAGAACAGATGGTGTCAACATCCTATGCTCTTTTGTGATTTGGAATCCTGCATATGATGGTGTATATACCATCTTCCCTGTGATATTTTGGTCACTTGCACATGAGAGCAATACTGATTTACTACCTCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.76

Weight (kDa)

4.37

Isoelectric Point (pI)

39.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 44
AluBI AGCT 1 cut(s) 7
AluI AGCT 1 cut(s) 7
BccI CCATC 3 cut(s) 53, 101, 128
BseGI GGATG 1 cut(s) 69
BstF5I GGATG 1 cut(s) 69
BtsCI GGATG 1 cut(s) 69
CviAII CATG 1 cut(s) 152
CviJI RGCY 1 cut(s) 7
CviKI_1 RGCY 1 cut(s) 7
FaeI CATG 1 cut(s) 155
FaiI YATR 6 cut(s) 76, 103, 105, 115, 117, 153
FatI CATG 1 cut(s) 151
FauNDI CATATG 1 cut(s) 103
FblI GTMKAC 1 cut(s) 44
FokI GGATG 1 cut(s) 56
Hin1II CATG 1 cut(s) 155
HincII GTYRAC 1 cut(s) 67
HindII GTYRAC 1 cut(s) 67
HinfI GANTC 1 cut(s) 94
Hpy166II GTNNAC 2 cut(s) 45, 67
Hpy8I GTNNAC 2 cut(s) 45, 67
HpyCH4V TGCA 3 cut(s) 37, 101, 149
Hsp92II CATG 1 cut(s) 155
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 2 cut(s) 111, 141
MaeIII GTNAC 1 cut(s) 141
MboII GAAGA 1 cut(s) 115
NdeI CATATG 1 cut(s) 103
NlaIII CATG 1 cut(s) 155
NmuCI GTSAC 1 cut(s) 141
PfeI GAWTC 1 cut(s) 94
SetI ASST 2 cut(s) 9, 178
SgeI CNNG 8 cut(s) 20, 25, 50, 63, 110, 140, 158, 164
TaqI TCGA 1 cut(s) 17
TfiI GAWTC 1 cut(s) 94
TseFI GTSAC 1 cut(s) 141
Tsp45I GTSAC 1 cut(s) 141
XmiI GTMKAC 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.