RchiOBHm_Chr2g0137291

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
54957051 .. 54957432
382 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50806

Sequence Viewer

Length: 246 bp
ATGGTGGCCTTTGAAATTGTTTTGCAAGGGCTTCATATAAGAAAGAAGCAATGGAAGGTGCAGCACCAAATCAAAAGATGTTATGCTGTGATCGTGTCCGAAAACGCAAGGAGGAGAAAGGCTTCTTCTCTGCTTGTTTGTTTGTTTTGTTCTGCTGCTGTTGCTGCTATGGTGGCTGCTGCTGTTGCTGCTATGGTGGCTGCTGCTGTGGCCCTTAGATTTCTTGCCATTGAGTGGGATCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.94

Weight (kDa)

10.05

Isoelectric Point (pI)

54.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 234
AfiI CCNNNNNNNGG 1 cut(s) 234
AgsI TTSAA 1 cut(s) 14
AoxI GGCC 2 cut(s) 6, 210
ApeKI GCWGC 8 cut(s) 61, 155, 164, 176, 179, 188, 200, 203
Asp700I GAANNNNTTC 1 cut(s) 121
AspS9I GGNCC 1 cut(s) 211
BbvI GCAGC 8 cut(s) 73, 142, 151, 163, 166, 175, 187, 190
BisI GCNGC 8 cut(s) 62, 156, 165, 177, 180, 189, 201, 204
BlsI GCNGC 8 cut(s) 63, 157, 166, 178, 181, 190, 202, 205
BmgT120I GGNCC 1 cut(s) 211
Bsc4I CCNNNNNNNGG 1 cut(s) 234
Bse3DI GCAATG 1 cut(s) 56
BseLI CCNNNNNNNGG 1 cut(s) 234
BseMI GCAATG 1 cut(s) 56
BseRI GAGGAG 1 cut(s) 127
BseXI GCAGC 8 cut(s) 73, 142, 151, 163, 166, 175, 187, 190
BsgI GTGCAG 1 cut(s) 80
BshFI GGCC 2 cut(s) 8, 212
BslI CCNNNNNNNGG 1 cut(s) 234
BsnI GGCC 2 cut(s) 8, 212
Bsp143I GATC 2 cut(s) 90, 238
BspANI GGCC 2 cut(s) 8, 212
BsrDI GCAATG 1 cut(s) 56
BssMI GATC 2 cut(s) 90, 238
BstDEI CTNAG 1 cut(s) 215
BstKTI GATC 2 cut(s) 93, 241
BstMBI GATC 2 cut(s) 90, 238
BstMWI GCNNNNNNNGC 7 cut(s) 161, 164, 173, 185, 188, 197, 209
BstV1I GCAGC 8 cut(s) 73, 142, 151, 163, 166, 175, 187, 190
BsuRI GGCC 2 cut(s) 8, 212
Cfr13I GGNCC 1 cut(s) 211
CviJI RGCY 6 cut(s) 8, 31, 122, 176, 200, 212
CviKI_1 RGCY 6 cut(s) 8, 31, 122, 176, 200, 212
DdeI CTNAG 1 cut(s) 215
DpnI GATC 2 cut(s) 92, 240
DpnII GATC 2 cut(s) 90, 238
FaiI YATR 5 cut(s) 36, 38, 84, 170, 194
Fnu4HI GCNGC 8 cut(s) 62, 156, 165, 177, 180, 189, 201, 204
Fsp4HI GCNGC 8 cut(s) 62, 156, 165, 177, 180, 189, 201, 204
GluI GCNGC 8 cut(s) 62, 156, 165, 177, 180, 189, 201, 204
HaeIII GGCC 2 cut(s) 8, 212
Hpy188I TCNGA 1 cut(s) 100
HpyAV CCTTC 1 cut(s) 49
HpyCH4V TGCA 2 cut(s) 25, 61
HpyF10VI GCNNNNNNNGC 7 cut(s) 161, 164, 173, 185, 188, 197, 209
HpyF3I CTNAG 1 cut(s) 215
Kzo9I GATC 2 cut(s) 90, 238
Lsp1109I GCAGC 8 cut(s) 73, 142, 151, 163, 166, 175, 187, 190
MalI GATC 2 cut(s) 92, 240
MboI GATC 2 cut(s) 90, 238
MboII GAAGA 1 cut(s) 117
MluCI AATT 1 cut(s) 15
MnlI CCTC 1 cut(s) 105
MroXI GAANNNNTTC 1 cut(s) 121
MwoI GCNNNNNNNGC 7 cut(s) 161, 164, 173, 185, 188, 197, 209
NdeII GATC 2 cut(s) 90, 238
PdmI GAANNNNTTC 1 cut(s) 121
PflMI CCANNNNNTGG 1 cut(s) 234
PkrI GCNGC 8 cut(s) 63, 157, 166, 178, 181, 190, 202, 205
PspPI GGNCC 1 cut(s) 211
SatI GCNGC 8 cut(s) 62, 156, 165, 177, 180, 189, 201, 204
Sau3AI GATC 2 cut(s) 90, 238
Sau96I GGNCC 1 cut(s) 211
SetI ASST 1 cut(s) 60
SgeI CNNG 5 cut(s) 38, 106, 120, 146, 236
Sse9I AATT 1 cut(s) 15
TasI AATT 1 cut(s) 15
TseI GCWGC 8 cut(s) 61, 155, 164, 176, 179, 188, 200, 203
TspDTI ATGAA 1 cut(s) 23
Van91I CCANNNNNTGG 1 cut(s) 234
XmnI GAANNNNTTC 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.