Rh2BG396900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
56282140 .. 56282598
459 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG396900.1

Sequence Viewer

Length: 261 bp
ATGACAGCCAATAAGAAGGCCACTCTTTGCCGTTCTCATTCTCCTAACTACCATCATAAATGGGCAAGGCTTCATATAAGAAAGAAGCAATGGAAGGTGCAGCACCAAATCAAAAGATGTTATGCTGTGATCGTGTCCGAAAACGCAAGGAGGAGAAAGGCTTCTTCTCTGCTTGTTTGTTTGTTTTGTTCTGCTGCTGTTGCTGCTATGGTGGCTGCTGCTGTGGCCCTTAGATTTCTTGCCATCGAGTGGGATCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.89

Weight (kDa)

10.56

Isoelectric Point (pI)

62.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 249
AfiI CCNNNNNNNGG 1 cut(s) 249
AoxI GGCC 2 cut(s) 18, 225
ApeKI GCWGC 5 cut(s) 100, 194, 203, 215, 218
Asp700I GAANNNNTTC 1 cut(s) 160
AspS9I GGNCC 1 cut(s) 226
BbvI GCAGC 5 cut(s) 112, 181, 190, 202, 205
BccI CCATC 2 cut(s) 60, 251
BceAI ACGGC 1 cut(s) 15
BisI GCNGC 5 cut(s) 101, 195, 204, 216, 219
BlsI GCNGC 5 cut(s) 102, 196, 205, 217, 220
BmgT120I GGNCC 1 cut(s) 226
Bsc4I CCNNNNNNNGG 1 cut(s) 249
Bse3DI GCAATG 1 cut(s) 95
BseLI CCNNNNNNNGG 1 cut(s) 249
BseMI GCAATG 1 cut(s) 95
BseRI GAGGAG 1 cut(s) 166
BseXI GCAGC 5 cut(s) 112, 181, 190, 202, 205
BsgI GTGCAG 1 cut(s) 119
BshFI GGCC 2 cut(s) 20, 227
BslI CCNNNNNNNGG 1 cut(s) 249
BsnI GGCC 2 cut(s) 20, 227
Bsp143I GATC 2 cut(s) 129, 253
BspANI GGCC 2 cut(s) 20, 227
BsrDI GCAATG 1 cut(s) 95
BssMI GATC 2 cut(s) 129, 253
BstDEI CTNAG 1 cut(s) 230
BstKTI GATC 2 cut(s) 132, 256
BstMBI GATC 2 cut(s) 129, 253
BstMWI GCNNNNNNNGC 4 cut(s) 200, 203, 212, 224
BstV1I GCAGC 5 cut(s) 112, 181, 190, 202, 205
BsuRI GGCC 2 cut(s) 20, 227
Cfr13I GGNCC 1 cut(s) 226
CviJI RGCY 6 cut(s) 8, 20, 70, 161, 215, 227
CviKI_1 RGCY 6 cut(s) 8, 20, 70, 161, 215, 227
DdeI CTNAG 1 cut(s) 230
DpnI GATC 2 cut(s) 131, 255
DpnII GATC 2 cut(s) 129, 253
FaiI YATR 5 cut(s) 57, 75, 77, 123, 209
Fnu4HI GCNGC 5 cut(s) 101, 195, 204, 216, 219
Fsp4HI GCNGC 5 cut(s) 101, 195, 204, 216, 219
GluI GCNGC 5 cut(s) 101, 195, 204, 216, 219
HaeIII GGCC 2 cut(s) 20, 227
Hpy188I TCNGA 1 cut(s) 139
HpyAV CCTTC 2 cut(s) 10, 88
HpyCH4V TGCA 1 cut(s) 100
HpyF10VI GCNNNNNNNGC 4 cut(s) 200, 203, 212, 224
HpyF3I CTNAG 1 cut(s) 230
Kzo9I GATC 2 cut(s) 129, 253
Lsp1109I GCAGC 5 cut(s) 112, 181, 190, 202, 205
MalI GATC 2 cut(s) 131, 255
MboI GATC 2 cut(s) 129, 253
MboII GAAGA 1 cut(s) 156
MnlI CCTC 1 cut(s) 144
MroXI GAANNNNTTC 1 cut(s) 160
MwoI GCNNNNNNNGC 4 cut(s) 200, 203, 212, 224
NdeII GATC 2 cut(s) 129, 253
PdmI GAANNNNTTC 1 cut(s) 160
PflMI CCANNNNNTGG 1 cut(s) 249
PkrI GCNGC 5 cut(s) 102, 196, 205, 217, 220
PspPI GGNCC 1 cut(s) 226
SatI GCNGC 5 cut(s) 101, 195, 204, 216, 219
Sau3AI GATC 2 cut(s) 129, 253
Sau96I GGNCC 1 cut(s) 226
SetI ASST 1 cut(s) 99
SgeI CNNG 5 cut(s) 78, 145, 159, 185, 251
TaqI TCGA 1 cut(s) 246
TseI GCWGC 5 cut(s) 100, 194, 203, 215, 218
TspDTI ATGAA 1 cut(s) 62
Van91I CCANNNNNTGG 1 cut(s) 249
XmnI GAANNNNTTC 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.