Rh2DG411900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
59725019 .. 59725477
459 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG411900.1

Sequence Viewer

Length: 261 bp
ATGAGAGCCAATAAGAAGGCCACTCTTTGCCATTCTCATTCTCCTAACTACGATCATAAATGGGGAAGGCTTCATATAAGAAAGAAGCAATGGAAGGTGCAGCGCGAAATCAAAAGATGTTATGCTGTGATCATGTCCGAAAACGCAAGGAGGAGAAAGGCTTCTTCTCTGCTTGTTTGTTTGCTTTGTTCTGCTGCTGTTGCTGCTATGGTGGCTGCTGCTGTGGCCCTTAGATTTCTTGCCATTGAGTGGGATCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.91

Weight (kDa)

10.36

Isoelectric Point (pI)

70.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 249
AccII CGCG 1 cut(s) 105
AfiI CCNNNNNNNGG 1 cut(s) 249
AoxI GGCC 2 cut(s) 18, 225
ApeKI GCWGC 5 cut(s) 100, 194, 203, 215, 218
Asp700I GAANNNNTTC 1 cut(s) 160
AspLEI GCGC 1 cut(s) 105
AspS9I GGNCC 1 cut(s) 226
BbvI GCAGC 5 cut(s) 112, 181, 190, 202, 205
BclI TGATCA 1 cut(s) 129
BisI GCNGC 5 cut(s) 101, 195, 204, 216, 219
BlsI GCNGC 5 cut(s) 102, 196, 205, 217, 220
BmgT120I GGNCC 1 cut(s) 226
Bsc4I CCNNNNNNNGG 1 cut(s) 249
Bse3DI GCAATG 1 cut(s) 95
BseLI CCNNNNNNNGG 1 cut(s) 249
BseMI GCAATG 1 cut(s) 95
BseRI GAGGAG 1 cut(s) 166
BseXI GCAGC 5 cut(s) 112, 181, 190, 202, 205
BsgI GTGCAG 1 cut(s) 119
Bsh1236I CGCG 1 cut(s) 105
BshFI GGCC 2 cut(s) 20, 227
BslI CCNNNNNNNGG 1 cut(s) 249
BsnI GGCC 2 cut(s) 20, 227
Bsp143I GATC 3 cut(s) 52, 129, 253
BspANI GGCC 2 cut(s) 20, 227
BspFNI CGCG 1 cut(s) 105
BsrDI GCAATG 1 cut(s) 95
BssMI GATC 3 cut(s) 52, 129, 253
BstDEI CTNAG 1 cut(s) 230
BstFNI CGCG 1 cut(s) 105
BstHHI GCGC 1 cut(s) 105
BstKTI GATC 3 cut(s) 55, 132, 256
BstMBI GATC 3 cut(s) 52, 129, 253
BstMWI GCNNNNNNNGC 4 cut(s) 200, 203, 212, 224
BstUI CGCG 1 cut(s) 105
BstV1I GCAGC 5 cut(s) 112, 181, 190, 202, 205
BsuRI GGCC 2 cut(s) 20, 227
CfoI GCGC 1 cut(s) 105
Cfr13I GGNCC 1 cut(s) 226
CviAII CATG 1 cut(s) 133
CviJI RGCY 6 cut(s) 8, 20, 70, 161, 215, 227
CviKI_1 RGCY 6 cut(s) 8, 20, 70, 161, 215, 227
DdeI CTNAG 1 cut(s) 230
DpnI GATC 3 cut(s) 54, 131, 255
DpnII GATC 3 cut(s) 52, 129, 253
FaeI CATG 1 cut(s) 136
FaiI YATR 6 cut(s) 57, 75, 77, 123, 134, 209
FatI CATG 1 cut(s) 132
FbaI TGATCA 1 cut(s) 129
Fnu4HI GCNGC 5 cut(s) 101, 195, 204, 216, 219
Fsp4HI GCNGC 5 cut(s) 101, 195, 204, 216, 219
GlaI GCGC 1 cut(s) 104
GluI GCNGC 5 cut(s) 101, 195, 204, 216, 219
HaeIII GGCC 2 cut(s) 20, 227
HhaI GCGC 1 cut(s) 105
Hin1II CATG 1 cut(s) 136
Hin6I GCGC 1 cut(s) 103
HinP1I GCGC 1 cut(s) 103
Hpy188I TCNGA 1 cut(s) 139
HpyAV CCTTC 3 cut(s) 10, 60, 88
HpyCH4V TGCA 1 cut(s) 100
HpyF10VI GCNNNNNNNGC 4 cut(s) 200, 203, 212, 224
HpyF3I CTNAG 1 cut(s) 230
Hsp92II CATG 1 cut(s) 136
HspAI GCGC 1 cut(s) 103
Ksp22I TGATCA 1 cut(s) 129
Kzo9I GATC 3 cut(s) 52, 129, 253
Lsp1109I GCAGC 5 cut(s) 112, 181, 190, 202, 205
MalI GATC 3 cut(s) 54, 131, 255
MboI GATC 3 cut(s) 52, 129, 253
MboII GAAGA 1 cut(s) 156
MnlI CCTC 1 cut(s) 144
MroXI GAANNNNTTC 1 cut(s) 160
MvnI CGCG 1 cut(s) 105
MwoI GCNNNNNNNGC 4 cut(s) 200, 203, 212, 224
NdeII GATC 3 cut(s) 52, 129, 253
NlaIII CATG 1 cut(s) 136
PdmI GAANNNNTTC 1 cut(s) 160
PflMI CCANNNNNTGG 1 cut(s) 249
PkrI GCNGC 5 cut(s) 102, 196, 205, 217, 220
PspPI GGNCC 1 cut(s) 226
SatI GCNGC 5 cut(s) 101, 195, 204, 216, 219
Sau3AI GATC 3 cut(s) 52, 129, 253
Sau96I GGNCC 1 cut(s) 226
SetI ASST 1 cut(s) 99
SgeI CNNG 5 cut(s) 116, 145, 159, 185, 251
TseI GCWGC 5 cut(s) 100, 194, 203, 215, 218
TspDTI ATGAA 1 cut(s) 62
Van91I CCANNNNNTGG 1 cut(s) 249
XmnI GAANNNNTTC 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.