RchiOBHm_Chr2g0149091

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
66920405 .. 66923535
3131 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51851

Sequence Viewer

Length: 156 bp
ATGCTGGCGAGTGGCGACTCATGCTCTATGATATACGACTTCATTATGAGAAATGGTTGGCATGGGGCATCATATCAAGCTATAGTCAGCCTCTTCAAGTACTCATGTAATCAATCTAAAGACAATTCTAATCTAGCTAGTATGTTCTATATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.77

Weight (kDa)

6.49

Isoelectric Point (pI)

39.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 101
AgsI TTSAA 1 cut(s) 97
AluBI AGCT 2 cut(s) 80, 137
AluI AGCT 2 cut(s) 80, 137
BfaI CTAG 2 cut(s) 134, 138
BfmI CTRYAG 1 cut(s) 81
BmcAI AGTACT 1 cut(s) 101
BmsI GCATC 1 cut(s) 77
Bst6I CTCTTC 1 cut(s) 98
BstC8I GCNNGC 1 cut(s) 6
BstMWI GCNNNNNNNGC 1 cut(s) 21
BstSFI CTRYAG 1 cut(s) 81
Cac8I GCNNGC 1 cut(s) 6
Csp6I GTAC 1 cut(s) 100
CviAII CATG 3 cut(s) 21, 62, 105
CviJI RGCY 3 cut(s) 80, 90, 137
CviKI_1 RGCY 3 cut(s) 80, 90, 137
CviQI GTAC 1 cut(s) 100
Eam1104I CTCTTC 1 cut(s) 98
EarI CTCTTC 1 cut(s) 98
FaeI CATG 3 cut(s) 24, 65, 108
FatI CATG 3 cut(s) 20, 61, 104
FspBI CTAG 2 cut(s) 134, 138
FspEI CC 6 cut(s) 39, 43, 48, 49, 50, 104
Hin1II CATG 3 cut(s) 24, 65, 108
HinfI GANTC 1 cut(s) 17
HpyF10VI GCNNNNNNNGC 1 cut(s) 21
Hsp92II CATG 3 cut(s) 24, 65, 108
LweI GCATC 1 cut(s) 77
MaeI CTAG 2 cut(s) 134, 138
MboII GAAGA 1 cut(s) 85
MluCI AATT 1 cut(s) 124
MlyI GAGTC 1 cut(s) 11
MnlI CCTC 1 cut(s) 101
MwoI GCNNNNNNNGC 1 cut(s) 21
NlaIII CATG 3 cut(s) 24, 65, 108
PleI GAGTC 1 cut(s) 11
PpsI GAGTC 1 cut(s) 11
RsaI GTAC 1 cut(s) 101
RsaNI GTAC 1 cut(s) 100
ScaI AGTACT 1 cut(s) 101
SchI GAGTC 1 cut(s) 11
SetI ASST 2 cut(s) 82, 139
SfaNI GCATC 1 cut(s) 77
SfcI CTRYAG 1 cut(s) 81
SgeI CNNG 9 cut(s) 17, 21, 33, 74, 89, 109, 117, 146, 150
Sse9I AATT 1 cut(s) 124
SspMI CTAG 2 cut(s) 134, 138
TasI AATT 1 cut(s) 124
TatI WGTACW 1 cut(s) 99
TspDTI ATGAA 1 cut(s) 31
XspI CTAG 2 cut(s) 134, 138
ZrmI AGTACT 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.