Rroxscaffold_7G00175750

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Reverse (-)
15249808 .. 15253545
3738 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00175750.1

Sequence Viewer

Length: 159 bp
ATGATGTACGACTTCTTTATAGGAAATGGTTGGCATGTGGCATCATATCAAGCTATAATCAGCCCCTTCAAGTACTCATGTAATCAATTTGATGACAATTCTAATCTAGCTAGCATGTTTATATTTGAAAACCAGTTTAATTATACTATGATTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

6.18

Weight (kDa)

4.22

Isoelectric Point (pI)

33.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 8, 74
AgsI TTSAA 2 cut(s) 70, 128
AluBI AGCT 2 cut(s) 53, 110
AluI AGCT 2 cut(s) 53, 110
AsuNHI GCTAGC 1 cut(s) 110
BfaI CTAG 2 cut(s) 107, 111
BmcAI AGTACT 1 cut(s) 74
BmsI GCATC 1 cut(s) 50
BmtI GCTAGC 1 cut(s) 114
Bse1I ACTGG 1 cut(s) 133
BseNI ACTGG 1 cut(s) 133
BspOI GCTAGC 1 cut(s) 114
BsrI ACTGG 1 cut(s) 133
BstC8I GCNNGC 1 cut(s) 112
BstNSI RCATGY 2 cut(s) 38, 118
Cac8I GCNNGC 1 cut(s) 112
Csp6I GTAC 2 cut(s) 7, 73
CviAII CATG 3 cut(s) 35, 78, 115
CviJI RGCY 3 cut(s) 53, 63, 110
CviKI_1 RGCY 3 cut(s) 53, 63, 110
CviQI GTAC 2 cut(s) 7, 73
FaeI CATG 3 cut(s) 38, 81, 118
FaiI YATR 9 cut(s) 20, 36, 46, 56, 79, 116, 122, 144, 149
FatI CATG 3 cut(s) 34, 77, 114
FspBI CTAG 2 cut(s) 107, 111
FspEI CC 8 cut(s) 6, 12, 16, 23, 77, 78, 79, 146
Hin1II CATG 3 cut(s) 38, 81, 118
HpyAV CCTTC 1 cut(s) 76
Hsp92II CATG 3 cut(s) 38, 81, 118
LpnPI CCDG 1 cut(s) 146
LweI GCATC 1 cut(s) 50
MaeI CTAG 2 cut(s) 107, 111
MluCI AATT 3 cut(s) 86, 97, 139
MseI TTAA 1 cut(s) 138
NheI GCTAGC 1 cut(s) 110
NlaIII CATG 3 cut(s) 38, 81, 118
NspI RCATGY 2 cut(s) 38, 118
RsaI GTAC 2 cut(s) 8, 74
RsaNI GTAC 2 cut(s) 7, 73
SaqAI TTAA 1 cut(s) 138
ScaI AGTACT 1 cut(s) 74
SetI ASST 2 cut(s) 55, 112
SfaNI GCATC 1 cut(s) 50
SgeI CNNG 8 cut(s) 47, 62, 82, 90, 119, 123, 127, 145
Sse9I AATT 3 cut(s) 86, 97, 139
SspMI CTAG 2 cut(s) 107, 111
TasI AATT 3 cut(s) 86, 97, 139
TatI WGTACW 1 cut(s) 72
Tru1I TTAA 1 cut(s) 138
Tru9I TTAA 1 cut(s) 138
XceI RCATGY 2 cut(s) 38, 118
XspI CTAG 2 cut(s) 107, 111
ZrmI AGTACT 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.