RchiOBHm_Chr6g0277751

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
40264551 .. 40268061
3511 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24918

Sequence Viewer

Length: 144 bp
ATGGAGATCTGCTCTATGATGTATGACTTCTTTATGGTAAATGGTTGGCATGTGGCATCATATCAAGCTATAATCAGCCCTTTCAAGTACTCATGTAATCAATCCGAATACAATTCTAATCTAGCTAGCATGTTCTATATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

47

Amino Acids

5.56

Weight (kDa)

4.65

Isoelectric Point (pI)

62.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 89
AgsI TTSAA 1 cut(s) 85
AluBI AGCT 2 cut(s) 68, 125
AluI AGCT 2 cut(s) 68, 125
AsuNHI GCTAGC 1 cut(s) 125
BfaI CTAG 2 cut(s) 122, 126
BglII AGATCT 1 cut(s) 6
BmcAI AGTACT 1 cut(s) 89
BmsI GCATC 1 cut(s) 65
BmtI GCTAGC 1 cut(s) 129
BplI GAGNNNNNCTC 1 cut(s) 28
Bsp143I GATC 1 cut(s) 6
BspOI GCTAGC 1 cut(s) 129
BssMI GATC 1 cut(s) 6
BstC8I GCNNGC 1 cut(s) 127
BstKTI GATC 1 cut(s) 9
BstMBI GATC 1 cut(s) 6
BstNSI RCATGY 2 cut(s) 53, 133
BstX2I RGATCY 1 cut(s) 6
BstYI RGATCY 1 cut(s) 6
Cac8I GCNNGC 1 cut(s) 127
Csp6I GTAC 1 cut(s) 88
CviAII CATG 3 cut(s) 50, 93, 130
CviJI RGCY 3 cut(s) 68, 78, 125
CviKI_1 RGCY 3 cut(s) 68, 78, 125
CviQI GTAC 1 cut(s) 88
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
FaeI CATG 3 cut(s) 53, 96, 133
FaiI YATR 9 cut(s) 17, 24, 35, 51, 61, 71, 94, 131, 138
FatI CATG 3 cut(s) 49, 92, 129
FspBI CTAG 2 cut(s) 122, 126
FspEI CC 7 cut(s) 20, 27, 31, 38, 92, 93, 118
Hin1II CATG 3 cut(s) 53, 96, 133
Hpy188I TCNGA 1 cut(s) 106
Hsp92II CATG 3 cut(s) 53, 96, 133
Kzo9I GATC 1 cut(s) 6
LweI GCATC 1 cut(s) 65
MaeI CTAG 2 cut(s) 122, 126
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MflI RGATCY 1 cut(s) 6
MluCI AATT 1 cut(s) 112
NdeII GATC 1 cut(s) 6
NheI GCTAGC 1 cut(s) 125
NlaIII CATG 3 cut(s) 53, 96, 133
NspI RCATGY 2 cut(s) 53, 133
PsuI RGATCY 1 cut(s) 6
RsaI GTAC 1 cut(s) 89
RsaNI GTAC 1 cut(s) 88
Sau3AI GATC 1 cut(s) 6
ScaI AGTACT 1 cut(s) 89
SetI ASST 2 cut(s) 70, 127
SfaNI GCATC 1 cut(s) 65
SgeI CNNG 6 cut(s) 62, 77, 97, 105, 134, 138
Sse9I AATT 1 cut(s) 112
SspMI CTAG 2 cut(s) 122, 126
TasI AATT 1 cut(s) 112
TatI WGTACW 1 cut(s) 87
XceI RCATGY 2 cut(s) 53, 133
XspI CTAG 2 cut(s) 122, 126
ZrmI AGTACT 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.