RchiOBHm_Chr3g0488241

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
35862264 .. 35862570
307 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45262

Sequence Viewer

Length: 192 bp
ATGCCCAACTTAACCACCAACTCCGGCTACGAGATATCCATCCGTAGCCGCCTCGTCAAGCGGGTCACCTGGGCCTATCTCCAGTCCGTGTCCTCCACTTGCGGCCCACACTTGCTCCGCCGCCTCTGGCTCAAGTTCACCCCCTGCCTCTCCTTCATCACCCACTGCCATCATTTTGGAAATTTCATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.34

Weight (kDa)

10.08

Isoelectric Point (pI)

56.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 5 cut(s) 49, 61, 102, 118, 121
AcsI RAATTY 1 cut(s) 181
AjnI CCWGG 1 cut(s) 68
AoxI GGCC 2 cut(s) 72, 103
ApoI RAATTY 1 cut(s) 181
AspS9I GGNCC 2 cut(s) 72, 104
AsuHPI GGTGA 3 cut(s) 58, 130, 151
BccI CCATC 2 cut(s) 47, 177
BciT130I CCWGG 1 cut(s) 70
BisI GCNGC 3 cut(s) 49, 103, 121
BlsI GCNGC 3 cut(s) 50, 104, 122
Bme1390I CCNGG 1 cut(s) 70
BmgT120I GGNCC 2 cut(s) 72, 104
BmrFI CCNGG 1 cut(s) 70
BpmI CTGGAG 1 cut(s) 65
BpuEI CTTGAG 1 cut(s) 116
BsaBI GATNNNNATC 1 cut(s) 38
BsaJI CCNNGG 1 cut(s) 69
BsaXI ACNNNNNCTCC 2 cut(s) 99, 129
Bse1I ACTGG 1 cut(s) 82
Bse8I GATNNNNATC 1 cut(s) 38
BseBI CCWGG 1 cut(s) 70
BseDI CCNNGG 1 cut(s) 69
BseGI GGATG 1 cut(s) 39
BseJI GATNNNNATC 1 cut(s) 38
BseNI ACTGG 1 cut(s) 82
BshFI GGCC 2 cut(s) 74, 105
BsiSI CCGG 1 cut(s) 24
BsnI GGCC 2 cut(s) 74, 105
BspACI CCGC 5 cut(s) 49, 61, 102, 118, 121
BspANI GGCC 2 cut(s) 74, 105
BsrI ACTGG 1 cut(s) 82
BssECI CCNNGG 1 cut(s) 69
Bst2UI CCWGG 1 cut(s) 70
BstEII GGTNACC 1 cut(s) 64
BstF5I GGATG 1 cut(s) 39
BstNI CCWGG 1 cut(s) 70
BstPI GGTNACC 1 cut(s) 64
BstSCI CCNGG 1 cut(s) 68
BstXI CCANNNNNNTGG 1 cut(s) 176
BsuRI GGCC 2 cut(s) 74, 105
BtsCI GGATG 1 cut(s) 39
BtsI GCAGTG 1 cut(s) 163
BtsIMutI CAGTG 1 cut(s) 163
Cfr13I GGNCC 2 cut(s) 72, 104
CviJI RGCY 5 cut(s) 27, 48, 74, 105, 130
CviKI_1 RGCY 5 cut(s) 27, 48, 74, 105, 130
EciI GGCGGA 1 cut(s) 107
Eco32I GATATC 1 cut(s) 36
Eco91I GGTNACC 1 cut(s) 64
EcoO65I GGTNACC 1 cut(s) 64
EcoRII CCWGG 1 cut(s) 68
EcoRV GATATC 1 cut(s) 36
FauI CCCGC 1 cut(s) 54
Fnu4HI GCNGC 3 cut(s) 49, 103, 121
FokI GGATG 1 cut(s) 26
Fsp4HI GCNGC 3 cut(s) 49, 103, 121
GluI GCNGC 3 cut(s) 49, 103, 121
GsuI CTGGAG 1 cut(s) 65
HaeIII GGCC 2 cut(s) 74, 105
HapII CCGG 1 cut(s) 24
HpaII CCGG 1 cut(s) 24
HphI GGTGA 3 cut(s) 58, 130, 151
Hpy166II GTNNAC 1 cut(s) 138
Hpy8I GTNNAC 1 cut(s) 138
HpyAV CCTTC 1 cut(s) 163
LmnI GCTCC 1 cut(s) 120
LpnPI CCDG 6 cut(s) 37, 55, 82, 95, 112, 157
MaeIII GTNAC 1 cut(s) 64
MluCI AATT 1 cut(s) 181
MnlI CCTC 4 cut(s) 62, 103, 134, 158
MseI TTAA 1 cut(s) 11
MspI CCGG 1 cut(s) 24
MspR9I CCNGG 1 cut(s) 70
MvaI CCWGG 1 cut(s) 70
NmuCI GTSAC 1 cut(s) 64
PkrI GCNGC 3 cut(s) 50, 104, 122
Psp6I CCWGG 1 cut(s) 68
PspEI GGTNACC 1 cut(s) 64
PspGI CCWGG 1 cut(s) 68
PspPI GGNCC 2 cut(s) 72, 104
SaqAI TTAA 1 cut(s) 11
SatI GCNGC 3 cut(s) 49, 103, 121
Sau96I GGNCC 2 cut(s) 72, 104
ScrFI CCNGG 1 cut(s) 70
SetI ASST 1 cut(s) 71
SmlI CTYRAG 1 cut(s) 131
SmoI CTYRAG 1 cut(s) 131
Sse9I AATT 1 cut(s) 181
SsiI CCGC 5 cut(s) 49, 61, 102, 118, 121
StyD4I CCNGG 1 cut(s) 68
TasI AATT 1 cut(s) 181
TauI GCSGC 3 cut(s) 51, 105, 123
Tru1I TTAA 1 cut(s) 11
Tru9I TTAA 1 cut(s) 11
TscAI CASTG 1 cut(s) 170
TseFI GTSAC 1 cut(s) 64
Tsp45I GTSAC 1 cut(s) 64
TspDTI ATGAA 2 cut(s) 145, 175
TspGWI ACGGA 2 cut(s) 32, 76
TspRI CASTG 1 cut(s) 170
XapI RAATTY 1 cut(s) 181
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.