RchiOBHm_Chr4g0432471

Multidrug Resistance

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
56654715 .. 56654945
231 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ40108

Sequence Viewer

Length: 231 bp
ATGGTTTACGTTGGTCAATTTGGAGTTCAATTGTCTGGAAGGCAAAAGCAAAGGGTTGCTATAGCAAGGCCTCTCGCTAGAAATCCCATAATCCTTCTGGTTGACGAAGCCACAAGCGCTTTCAATGCACAATCCAAAAGAGTAGTACGAGAATCCCAAGACGTGGCTTCAATAGGACGTACACCTCCATTGTTGCCCATCGGCTTTCCACAATATGCAAAGCTGAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

8.32

Weight (kDa)

10.92

Isoelectric Point (pI)

45.56

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ABC_tran PF00005 8 - 39 2.9e-06 ABC transporter
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 163
AfaI GTAC 2 cut(s) 147, 181
AfeI AGCGCT 1 cut(s) 118
AfiI CCNNNNNNNGG 1 cut(s) 163
AgsI TTSAA 3 cut(s) 29, 124, 171
AjiI CACGTC 1 cut(s) 163
AluBI AGCT 1 cut(s) 223
AluI AGCT 1 cut(s) 223
Aor51HI AGCGCT 1 cut(s) 118
AoxI GGCC 1 cut(s) 68
AspLEI GCGC 1 cut(s) 119
BccI CCATC 1 cut(s) 206
BfaI CTAG 1 cut(s) 78
BfmI CTRYAG 1 cut(s) 60
BfoI RGCGCY 1 cut(s) 120
BmgBI CACGTC 1 cut(s) 163
Bsc4I CCNNNNNNNGG 1 cut(s) 163
BseLI CCNNNNNNNGG 1 cut(s) 163
BseMII CTCAG 1 cut(s) 215
BshFI GGCC 1 cut(s) 70
BslI CCNNNNNNNGG 1 cut(s) 163
BsnI GGCC 1 cut(s) 70
BspANI GGCC 1 cut(s) 70
BspCNI CTCAG 1 cut(s) 216
BstDEI CTNAG 1 cut(s) 224
BstH2I RGCGCY 1 cut(s) 120
BstHHI GCGC 1 cut(s) 119
BstMWI GCNNNNNNNGC 2 cut(s) 116, 125
BstSFI CTRYAG 1 cut(s) 60
BsuRI GGCC 1 cut(s) 70
BtrI CACGTC 1 cut(s) 163
CfoI GCGC 1 cut(s) 119
Csp6I GTAC 2 cut(s) 146, 180
CviJI RGCY 5 cut(s) 70, 110, 167, 204, 223
CviKI_1 RGCY 5 cut(s) 70, 110, 167, 204, 223
CviQI GTAC 2 cut(s) 146, 180
DdeI CTNAG 1 cut(s) 224
Eco147I AGGCCT 1 cut(s) 70
Eco47III AGCGCT 1 cut(s) 118
FaiI YATR 3 cut(s) 62, 89, 216
FspBI CTAG 1 cut(s) 78
GlaI GCGC 1 cut(s) 118
HaeII RGCGCY 1 cut(s) 120
HaeIII GGCC 1 cut(s) 70
HhaI GCGC 1 cut(s) 119
Hin6I GCGC 1 cut(s) 117
HinP1I GCGC 1 cut(s) 117
HincII GTYRAC 1 cut(s) 103
HindII GTYRAC 1 cut(s) 103
HinfI GANTC 1 cut(s) 152
Hpy166II GTNNAC 3 cut(s) 7, 103, 182
Hpy188III TCNNGA 1 cut(s) 36
Hpy8I GTNNAC 3 cut(s) 7, 103, 182
HpyAV CCTTC 2 cut(s) 33, 104
HpyCH4IV ACGT 3 cut(s) 9, 162, 178
HpyCH4V TGCA 2 cut(s) 128, 218
HpyF10VI GCNNNNNNNGC 2 cut(s) 116, 125
HpyF3I CTNAG 1 cut(s) 224
HpySE526I ACGT 3 cut(s) 9, 162, 178
HspAI GCGC 1 cut(s) 117
LpnPI CCDG 2 cut(s) 21, 83
MaeI CTAG 1 cut(s) 78
MaeII ACGT 3 cut(s) 9, 162, 178
MfeI CAATTG 1 cut(s) 29
MluCI AATT 2 cut(s) 17, 29
MnlI CCTC 2 cut(s) 81, 195
MunI CAATTG 1 cut(s) 29
MwoI GCNNNNNNNGC 2 cut(s) 116, 125
PceI AGGCCT 1 cut(s) 70
PfeI GAWTC 1 cut(s) 152
PflMI CCANNNNNTGG 1 cut(s) 163
RsaI GTAC 2 cut(s) 147, 181
RsaNI GTAC 2 cut(s) 146, 180
SetI ASST 5 cut(s) 12, 165, 181, 187, 225
SfcI CTRYAG 1 cut(s) 60
SgeI CNNG 9 cut(s) 48, 78, 86, 90, 110, 126, 161, 170, 175
Sse9I AATT 2 cut(s) 17, 29
SseBI AGGCCT 1 cut(s) 70
SspMI CTAG 1 cut(s) 78
StuI AGGCCT 1 cut(s) 70
TaiI ACGT 3 cut(s) 12, 165, 181
TasI AATT 2 cut(s) 17, 29
TfiI GAWTC 1 cut(s) 152
Van91I CCANNNNNTGG 1 cut(s) 163
XcmI CCANNNNNNNNNTGG 1 cut(s) 94
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.