RchiOBHm_Chr4g0445391

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0001123
Physical Location & Seq
Reverse (-)
65838092 .. 65841753
3662 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ41298

Sequence Viewer

Length: 156 bp
ATGACTTCTATTACGGATGGTCTCTATATGTGTTTGGCTTCATCTCACTTAAATGGCGAGACTGAAATCTCAGATCTGTATGAAAGGTGCAACAAATTGGTTTTCTTTGTTAACTTTAGGGAATTGATTCTTTTCTTATGTTTGGTTGTTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.85

Weight (kDa)

4.64

Isoelectric Point (pI)

34.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Alw26I GTCTC 2 cut(s) 26, 53
Asp700I GAANNNNTTC 1 cut(s) 126
BccI CCATC 1 cut(s) 11
BcoDI GTCTC 2 cut(s) 26, 53
BglII AGATCT 1 cut(s) 73
BsaI GGTCTC 1 cut(s) 26
BseGI GGATG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 84
BsmAI GTCTC 2 cut(s) 26, 53
Bso31I GGTCTC 1 cut(s) 26
Bsp143I GATC 1 cut(s) 73
BspCNI CTCAG 1 cut(s) 83
BspTNI GGTCTC 1 cut(s) 26
BssMI GATC 1 cut(s) 73
BstDEI CTNAG 1 cut(s) 70
BstF5I GGATG 1 cut(s) 22
BstKTI GATC 1 cut(s) 76
BstMAI GTCTC 2 cut(s) 26, 53
BstMBI GATC 1 cut(s) 73
BstX2I RGATCY 1 cut(s) 73
BstYI RGATCY 1 cut(s) 73
BtsCI GGATG 1 cut(s) 22
CviJI RGCY 1 cut(s) 38
CviKI_1 RGCY 1 cut(s) 38
DdeI CTNAG 1 cut(s) 70
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
Eco31I GGTCTC 1 cut(s) 26
FaiI YATR 4 cut(s) 27, 29, 81, 139
FokI GGATG 1 cut(s) 29
FspEI CC 8 cut(s) 3, 20, 39, 70, 83, 103, 104, 128
HincII GTYRAC 1 cut(s) 112
HindII GTYRAC 1 cut(s) 112
HinfI GANTC 1 cut(s) 127
HpaI GTTAAC 1 cut(s) 112
Hpy166II GTNNAC 1 cut(s) 112
Hpy188I TCNGA 1 cut(s) 73
Hpy188III TCNNGA 1 cut(s) 153
Hpy8I GTNNAC 1 cut(s) 112
HpyCH4V TGCA 1 cut(s) 90
HpyF3I CTNAG 1 cut(s) 70
KspAI GTTAAC 1 cut(s) 112
Kzo9I GATC 1 cut(s) 73
MalI GATC 1 cut(s) 75
MboI GATC 1 cut(s) 73
MflI RGATCY 1 cut(s) 73
MluCI AATT 2 cut(s) 95, 122
MroXI GAANNNNTTC 1 cut(s) 126
MseI TTAA 2 cut(s) 50, 111
MslI CAYNNNNRTG 1 cut(s) 51
NdeII GATC 1 cut(s) 73
PdmI GAANNNNTTC 1 cut(s) 126
PfeI GAWTC 1 cut(s) 127
PsuI RGATCY 1 cut(s) 73
RseI CAYNNNNRTG 1 cut(s) 51
SaqAI TTAA 2 cut(s) 50, 111
Sau3AI GATC 1 cut(s) 73
SetI ASST 1 cut(s) 89
SgeI CNNG 1 cut(s) 70
SmiMI CAYNNNNRTG 1 cut(s) 51
Sse9I AATT 2 cut(s) 95, 122
TasI AATT 2 cut(s) 95, 122
TfiI GAWTC 1 cut(s) 127
Tru1I TTAA 2 cut(s) 50, 111
Tru9I TTAA 2 cut(s) 50, 111
TspDTI ATGAA 2 cut(s) 30, 96
TspGWI ACGGA 1 cut(s) 29
XmnI GAANNNNTTC 1 cut(s) 126
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.