RchiOBHm_Chr5g0012111

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
8096746 .. 8098215
1470 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ29272

Sequence Viewer

Length: 153 bp
ATGTGGCCCTTGCTTGTTCCTTGGATAGGTGAGACTTCGGCAAATCCTTTTCATGCGTGCTCAAGAGGATGGAGAAGCCAGGCCAAAGACCTTAGCTCAGTGATCAAGCATGCACATGTCGGTGATGAAGGCAGGGACACCCCTTACCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.64

Weight (kDa)

6.89

Isoelectric Point (pI)

39.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 26
AflIII ACRYGT 1 cut(s) 115
AjnI CCWGG 1 cut(s) 78
AluBI AGCT 1 cut(s) 96
AluI AGCT 1 cut(s) 96
Alw21I GWGCWC 1 cut(s) 62
Alw26I GTCTC 1 cut(s) 26
AoxI GGCC 2 cut(s) 5, 81
AspS9I GGNCC 1 cut(s) 6
AsuHPI GGTGA 2 cut(s) 41, 134
Bbv12I GWGCWC 1 cut(s) 62
BccI CCATC 1 cut(s) 63
BciT130I CCWGG 1 cut(s) 80
BclI TGATCA 1 cut(s) 102
BcoDI GTCTC 1 cut(s) 26
Bme1390I CCNGG 1 cut(s) 80
BmgT120I GGNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 80
Bpu10I CCTNAGC 1 cut(s) 92
BpuEI CTTGAG 1 cut(s) 46
BsaJI CCNNGG 1 cut(s) 20
Bsc4I CCNNNNNNNGG 1 cut(s) 26
BseBI CCWGG 1 cut(s) 80
BseDI CCNNGG 1 cut(s) 20
BseGI GGATG 1 cut(s) 74
BseLI CCNNNNNNNGG 1 cut(s) 26
BseMII CTCAG 1 cut(s) 111
BshFI GGCC 2 cut(s) 7, 83
BsiHKAI GWGCWC 1 cut(s) 62
BslFI GGGAC 1 cut(s) 149
BslI CCNNNNNNNGG 1 cut(s) 26
BsmAI GTCTC 1 cut(s) 26
BsmFI GGGAC 1 cut(s) 149
BsnI GGCC 2 cut(s) 7, 83
Bsp1286I GDGCHC 1 cut(s) 62
Bsp143I GATC 1 cut(s) 102
BspANI GGCC 2 cut(s) 7, 83
BspCNI CTCAG 1 cut(s) 110
BssECI CCNNGG 1 cut(s) 20
BssMI GATC 1 cut(s) 102
BssT1I CCWWGG 1 cut(s) 20
Bst2UI CCWGG 1 cut(s) 80
BstC8I GCNNGC 2 cut(s) 58, 111
BstDEI CTNAG 2 cut(s) 92, 97
BstENI CCTNNNNNAGG 1 cut(s) 24
BstF5I GGATG 1 cut(s) 74
BstKTI GATC 1 cut(s) 105
BstMAI GTCTC 1 cut(s) 26
BstMBI GATC 1 cut(s) 102
BstNI CCWGG 1 cut(s) 80
BstNSI RCATGY 2 cut(s) 113, 119
BstSCI CCNGG 1 cut(s) 78
BsuRI GGCC 2 cut(s) 7, 83
BtsCI GGATG 1 cut(s) 74
BtsIMutI CAGTG 1 cut(s) 105
Cac8I GCNNGC 2 cut(s) 58, 111
Cfr13I GGNCC 1 cut(s) 6
CviAII CATG 3 cut(s) 53, 110, 116
CviJI RGCY 4 cut(s) 7, 78, 83, 96
CviKI_1 RGCY 4 cut(s) 7, 78, 83, 96
DdeI CTNAG 2 cut(s) 92, 97
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
Eco130I CCWWGG 1 cut(s) 20
EcoNI CCTNNNNNAGG 1 cut(s) 24
EcoRII CCWGG 1 cut(s) 78
EcoT14I CCWWGG 1 cut(s) 20
ErhI CCWWGG 1 cut(s) 20
FaeI CATG 3 cut(s) 56, 113, 119
FaiI YATR 3 cut(s) 54, 111, 117
FaqI GGGAC 1 cut(s) 149
FatI CATG 3 cut(s) 52, 109, 115
FbaI TGATCA 1 cut(s) 102
FokI GGATG 1 cut(s) 81
HaeIII GGCC 2 cut(s) 7, 83
Hin1II CATG 3 cut(s) 56, 113, 119
HphI GGTGA 2 cut(s) 41, 134
Hpy188III TCNNGA 1 cut(s) 63
HpyAV CCTTC 1 cut(s) 122
HpyCH4V TGCA 1 cut(s) 113
HpyF3I CTNAG 2 cut(s) 92, 97
Hsp92II CATG 3 cut(s) 56, 113, 119
Ksp22I TGATCA 1 cut(s) 102
Kzo9I GATC 1 cut(s) 102
LpnPI CCDG 3 cut(s) 65, 92, 118
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MhlI GDGCHC 1 cut(s) 62
MnlI CCTC 1 cut(s) 59
MslI CAYNNNNRTG 2 cut(s) 114, 120
MspR9I CCNGG 1 cut(s) 80
MvaI CCWGG 1 cut(s) 80
NdeII GATC 1 cut(s) 102
NlaIII CATG 3 cut(s) 56, 113, 119
NspI RCATGY 2 cut(s) 113, 119
PaeI GCATGC 1 cut(s) 113
PciI ACATGT 1 cut(s) 115
PscI ACATGT 1 cut(s) 115
Psp6I CCWGG 1 cut(s) 78
PspGI CCWGG 1 cut(s) 78
PspPI GGNCC 1 cut(s) 6
RseI CAYNNNNRTG 2 cut(s) 114, 120
Sau3AI GATC 1 cut(s) 102
Sau96I GGNCC 1 cut(s) 6
ScrFI CCNGG 1 cut(s) 80
SduI GDGCHC 1 cut(s) 62
SetI ASST 3 cut(s) 31, 93, 98
SmiMI CAYNNNNRTG 2 cut(s) 114, 120
SmlI CTYRAG 1 cut(s) 61
SmoI CTYRAG 1 cut(s) 61
SphI GCATGC 1 cut(s) 113
StyD4I CCNGG 1 cut(s) 78
StyI CCWWGG 1 cut(s) 20
TscAI CASTG 1 cut(s) 105
TspDTI ATGAA 2 cut(s) 41, 141
TspRI CASTG 1 cut(s) 105
XagI CCTNNNNNAGG 1 cut(s) 24
XceI RCATGY 2 cut(s) 113, 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.