RchiOBHm_Chr5g0029651

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
23268112 .. 23268916
805 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30902

Sequence Viewer

Length: 180 bp
ATGGTGAGGCCCAACCGAGACATGCATCTTGTAGCCTTATGTTCAAGCTACGCTACGGTATCTGGAAGTCGCAAATCTGTCGCCGGGAACCCACCTTCCCGGCCTTGTCAACATGCCCTCACAAATAGGCTTTCTAGACTAGAAATAGTTGTTGCTTGTCCCACATTGAAAACCATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.42

Weight (kDa)

10.31

Isoelectric Point (pI)

53.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 45, 169
AloI GAACNNNNNNTCC 2 cut(s) 80, 112
AluBI AGCT 1 cut(s) 48
AluI AGCT 1 cut(s) 48
Alw26I GTCTC 1 cut(s) 12
AoxI GGCC 2 cut(s) 8, 101
AspS9I GGNCC 1 cut(s) 9
AsuC2I CCSGG 2 cut(s) 85, 100
AsuHPI GGTGA 1 cut(s) 16
BcgI CGANNNNNNTGC 2 cut(s) 61, 95
BcnI CCSGG 2 cut(s) 85, 100
BcoDI GTCTC 1 cut(s) 12
BfaI CTAG 2 cut(s) 135, 140
Bme1390I CCNGG 2 cut(s) 85, 100
BmgT120I GGNCC 1 cut(s) 9
BmiI GGNNCC 1 cut(s) 89
BmrFI CCNGG 2 cut(s) 85, 100
BmsI GCATC 1 cut(s) 34
BpuMI CCSGG 2 cut(s) 85, 100
BshFI GGCC 2 cut(s) 10, 103
BsiSI CCGG 2 cut(s) 84, 100
BslFI GGGAC 1 cut(s) 144
BsmAI GTCTC 1 cut(s) 12
BsmFI GGGAC 1 cut(s) 144
BsnI GGCC 2 cut(s) 10, 103
BspANI GGCC 2 cut(s) 10, 103
BspLI GGNNCC 1 cut(s) 89
Bst4CI ACNGT 1 cut(s) 58
BstMAI GTCTC 1 cut(s) 12
BstNSI RCATGY 2 cut(s) 25, 116
BstSCI CCNGG 2 cut(s) 83, 98
BsuRI GGCC 2 cut(s) 10, 103
Cfr13I GGNCC 1 cut(s) 9
CviAII CATG 3 cut(s) 22, 113, 175
CviJI RGCY 5 cut(s) 10, 35, 48, 103, 130
CviKI_1 RGCY 5 cut(s) 10, 35, 48, 103, 130
EcoT22I ATGCAT 1 cut(s) 27
FaeI CATG 3 cut(s) 25, 116, 178
FaiI YATR 4 cut(s) 23, 40, 114, 176
FaqI GGGAC 1 cut(s) 144
FatI CATG 3 cut(s) 21, 112, 174
FspBI CTAG 2 cut(s) 135, 140
HaeIII GGCC 2 cut(s) 10, 103
HapII CCGG 2 cut(s) 84, 100
Hin1II CATG 3 cut(s) 25, 116, 178
HincII GTYRAC 1 cut(s) 110
HindII GTYRAC 1 cut(s) 110
HpaII CCGG 2 cut(s) 84, 100
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 1 cut(s) 110
Hpy188III TCNNGA 2 cut(s) 63, 135
Hpy8I GTNNAC 1 cut(s) 110
HpyAV CCTTC 1 cut(s) 105
HpyCH4III ACNGT 1 cut(s) 58
HpyCH4V TGCA 1 cut(s) 25
Hsp92II CATG 3 cut(s) 25, 116, 178
LpnPI CCDG 3 cut(s) 48, 97, 113
LweI GCATC 1 cut(s) 34
MaeI CTAG 2 cut(s) 135, 140
MnlI CCTC 1 cut(s) 128
Mph1103I ATGCAT 1 cut(s) 27
MspI CCGG 2 cut(s) 84, 100
MspR9I CCNGG 2 cut(s) 85, 100
NciI CCSGG 2 cut(s) 85, 100
NlaIII CATG 3 cut(s) 25, 116, 178
NlaIV GGNNCC 1 cut(s) 89
NsiI ATGCAT 1 cut(s) 27
NspI RCATGY 2 cut(s) 25, 116
PspN4I GGNNCC 1 cut(s) 89
PspPI GGNCC 1 cut(s) 9
Sau96I GGNCC 1 cut(s) 9
ScrFI CCNGG 2 cut(s) 85, 100
SetI ASST 2 cut(s) 50, 97
SfaNI GCATC 1 cut(s) 34
SspMI CTAG 2 cut(s) 135, 140
StyD4I CCNGG 2 cut(s) 83, 98
TaaI ACNGT 1 cut(s) 58
XbaI TCTAGA 1 cut(s) 134
XceI RCATGY 2 cut(s) 25, 116
XspI CTAG 2 cut(s) 135, 140
Zsp2I ATGCAT 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.