RchiOBHm_Chr5g0058021

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
62139336 .. 62143917
4582 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33474

Sequence Viewer

Length: 264 bp
ATGGCTGAGAGAAGTATATTCCAGAATGCTGATACATACTGGTTTCTAATAAATGGTATTTGCAAGGTTGGAGAGATGGGGCTGGCAATGCAATATGTTAATGAGATGCAGAACAAGGGATTTGAATTAGACAATCATGACTGCAACATCTTGGCTGATGGTTTTCGCAGCAAAGGGATGACCAACGAGCTTTTTGAGTTACATGCGTTGATGGAGAAAAAAAGTTCTAAAGCTAATGGCTTTAAACAGAAGAAAAATGGATAG

Protein Analysis

87

Amino Acids

9.93

Weight (kDa)

6.72

Isoelectric Point (pI)

14.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_2 PF13041 10 - 55 6.1e-08 PPR repeat family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 125
AluBI AGCT 2 cut(s) 190, 233
AluI AGCT 2 cut(s) 190, 233
ApeKI GCWGC 1 cut(s) 168
BbvI GCAGC 1 cut(s) 180
BccI CCATC 3 cut(s) 70, 152, 205
BisI GCNGC 1 cut(s) 169
BlsI GCNGC 1 cut(s) 170
BmsI GCATC 1 cut(s) 96
Bse1I ACTGG 1 cut(s) 44
Bse3DI GCAATG 1 cut(s) 93
BseGI GGATG 1 cut(s) 183
BseMI GCAATG 1 cut(s) 93
BseNI ACTGG 1 cut(s) 44
BseXI GCAGC 1 cut(s) 180
BsmI GAATGC 1 cut(s) 31
BspHI TCATGA 1 cut(s) 136
BsrDI GCAATG 1 cut(s) 93
BsrI ACTGG 1 cut(s) 44
BstC8I GCNNGC 1 cut(s) 84
BstDEI CTNAG 1 cut(s) 6
BstF5I GGATG 1 cut(s) 183
BstMWI GCNNNNNNNGC 1 cut(s) 88
BstNSI RCATGY 1 cut(s) 206
BstV1I GCAGC 1 cut(s) 180
BtsCI GGATG 1 cut(s) 183
Cac8I GCNNGC 1 cut(s) 84
CciI TCATGA 1 cut(s) 136
CviAII CATG 2 cut(s) 137, 203
CviJI RGCY 6 cut(s) 5, 82, 155, 190, 233, 240
CviKI_1 RGCY 6 cut(s) 5, 82, 155, 190, 233, 240
DdeI CTNAG 1 cut(s) 6
DraI TTTAAA 1 cut(s) 244
FaeI CATG 2 cut(s) 140, 206
FaiI YATR 5 cut(s) 17, 37, 96, 138, 204
FatI CATG 2 cut(s) 136, 202
Fnu4HI GCNGC 1 cut(s) 169
FokI GGATG 1 cut(s) 190
Fsp4HI GCNGC 1 cut(s) 169
GluI GCNGC 1 cut(s) 169
Hin1II CATG 2 cut(s) 140, 206
Hpy188III TCNNGA 2 cut(s) 22, 137
HpyCH4V TGCA 4 cut(s) 63, 91, 109, 144
HpyF10VI GCNNNNNNNGC 1 cut(s) 88
HpyF3I CTNAG 1 cut(s) 6
Hsp92II CATG 2 cut(s) 140, 206
LpnPI CCDG 3 cut(s) 25, 35, 68
Lsp1109I GCAGC 1 cut(s) 180
LweI GCATC 1 cut(s) 96
MaeIII GTNAC 1 cut(s) 198
MboII GAAGA 1 cut(s) 262
MluCI AATT 1 cut(s) 125
MmeI TCCRAC 1 cut(s) 49
MseI TTAA 2 cut(s) 99, 243
Mva1269I GAATGC 1 cut(s) 31
MwoI GCNNNNNNNGC 1 cut(s) 88
NlaIII CATG 2 cut(s) 140, 206
NspI RCATGY 1 cut(s) 206
PagI TCATGA 1 cut(s) 136
PctI GAATGC 1 cut(s) 31
PkrI GCNGC 1 cut(s) 170
SaqAI TTAA 2 cut(s) 99, 243
SatI GCNGC 1 cut(s) 169
SetI ASST 3 cut(s) 69, 192, 235
SfaNI GCATC 1 cut(s) 96
SgeI CNNG 9 cut(s) 34, 52, 76, 95, 127, 149, 163, 199, 215
Sse9I AATT 1 cut(s) 125
TasI AATT 1 cut(s) 125
Tru1I TTAA 2 cut(s) 99, 243
Tru9I TTAA 2 cut(s) 99, 243
TseI GCWGC 1 cut(s) 168
XceI RCATGY 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.