Rw5G035720

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Forward (+)
62146582 .. 62153673
7092 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G035720.1

Sequence Viewer

Length: 207 bp
ATGGTGGATGCTTGTGCTAAGAGATGGAACTTTTCGGAGTTGGATCTTATATTGCTTTTGTTGGCAAAGGAAGGAGTGGCATTTGAGGTCAAGACATATCAAGCTGTCTTAAAGAAATTCGCTGTCACAGAAATTTCTCAGACTGTTGGAACAACATTCAGAGATTATACAAAATGGCTAATTCCAAAAGCCAACGCACTTTGTTAA

Protein Analysis

68

Amino Acids

7.71

Weight (kDa)

8.66

Isoelectric Point (pI)

37.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 51
AcsI RAATTY 2 cut(s) 116, 132
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
AlwI GGATC 1 cut(s) 51
ApoI RAATTY 2 cut(s) 116, 132
BccI CCATC 1 cut(s) 18
BseGI GGATG 1 cut(s) 13
BseMII CTCAG 1 cut(s) 152
Bsp143I GATC 1 cut(s) 43
BspCNI CTCAG 1 cut(s) 151
BspPI GGATC 1 cut(s) 51
BssMI GATC 1 cut(s) 43
Bst4CI ACNGT 1 cut(s) 145
BstDEI CTNAG 2 cut(s) 18, 138
BstF5I GGATG 1 cut(s) 13
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BstX2I RGATCY 1 cut(s) 43
BstYI RGATCY 1 cut(s) 43
BtsCI GGATG 1 cut(s) 13
CviJI RGCY 3 cut(s) 104, 178, 191
CviKI_1 RGCY 3 cut(s) 104, 178, 191
DdeI CTNAG 2 cut(s) 18, 138
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
FaiI YATR 3 cut(s) 50, 97, 168
FokI GGATG 1 cut(s) 20
Hpy188I TCNGA 3 cut(s) 37, 141, 161
Hpy188III TCNNGA 1 cut(s) 91
HpyAV CCTTC 1 cut(s) 65
HpyCH4III ACNGT 1 cut(s) 145
HpyF3I CTNAG 2 cut(s) 18, 138
Kzo9I GATC 1 cut(s) 43
MaeIII GTNAC 1 cut(s) 124
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MflI RGATCY 1 cut(s) 43
MluCI AATT 3 cut(s) 116, 132, 180
MmeI TCCRAC 2 cut(s) 21, 127
MnlI CCTC 1 cut(s) 79
MseI TTAA 2 cut(s) 110, 205
NdeII GATC 1 cut(s) 43
NmuCI GTSAC 1 cut(s) 124
PsuI RGATCY 1 cut(s) 43
SaqAI TTAA 2 cut(s) 110, 205
Sau3AI GATC 1 cut(s) 43
SetI ASST 2 cut(s) 90, 106
SgeI CNNG 3 cut(s) 24, 103, 113
Sse9I AATT 3 cut(s) 116, 132, 180
TaaI ACNGT 1 cut(s) 145
TasI AATT 3 cut(s) 116, 132, 180
Tru1I TTAA 2 cut(s) 110, 205
Tru9I TTAA 2 cut(s) 110, 205
TseFI GTSAC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 124
XapI RAATTY 2 cut(s) 116, 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.