Rroxscaffold_1G00022520

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Reverse (-)
27792978 .. 27793549
572 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00022520.1

Sequence Viewer

Length: 207 bp
ATGGTGGATGCTTGTGCTAAGAGATGGAACTTTTTGGAGTTGGATCTTATATTGCTTTTGTTGGCAAAGGAAGGAGTGGCATTTGAGGCCAAGACACATCAAGCTGTCTTAAAGAAATTCGCTGTCAGAGAAATTTCTCAGACTGTTGCAACAACATTCAGAGATTATACAAAACGACTAATTCCAAAAGCCAACACACTTTGTTAA

Protein Analysis

68

Amino Acids

7.75

Weight (kDa)

9.39

Isoelectric Point (pI)

37.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 51
AcsI RAATTY 2 cut(s) 116, 132
AluBI AGCT 1 cut(s) 104
AluI AGCT 1 cut(s) 104
AlwI GGATC 1 cut(s) 51
AoxI GGCC 1 cut(s) 87
ApoI RAATTY 2 cut(s) 116, 132
BccI CCATC 1 cut(s) 18
BseGI GGATG 1 cut(s) 13
BseMII CTCAG 1 cut(s) 152
BshFI GGCC 1 cut(s) 89
BsnI GGCC 1 cut(s) 89
Bsp143I GATC 1 cut(s) 43
BspANI GGCC 1 cut(s) 89
BspCNI CTCAG 1 cut(s) 151
BspPI GGATC 1 cut(s) 51
BssMI GATC 1 cut(s) 43
Bst4CI ACNGT 1 cut(s) 145
BstDEI CTNAG 2 cut(s) 18, 138
BstF5I GGATG 1 cut(s) 13
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstX2I RGATCY 1 cut(s) 43
BstYI RGATCY 1 cut(s) 43
BsuRI GGCC 1 cut(s) 89
BtsCI GGATG 1 cut(s) 13
CviJI RGCY 3 cut(s) 89, 104, 191
CviKI_1 RGCY 3 cut(s) 89, 104, 191
DdeI CTNAG 2 cut(s) 18, 138
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
FaiI YATR 2 cut(s) 50, 168
FokI GGATG 1 cut(s) 20
HaeIII GGCC 1 cut(s) 89
Hpy188I TCNGA 3 cut(s) 128, 141, 161
HpyAV CCTTC 1 cut(s) 65
HpyCH4III ACNGT 1 cut(s) 145
HpyCH4V TGCA 1 cut(s) 149
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 2 cut(s) 18, 138
Kzo9I GATC 1 cut(s) 43
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MflI RGATCY 1 cut(s) 43
MluCI AATT 3 cut(s) 116, 132, 180
MmeI TCCRAC 1 cut(s) 21
MnlI CCTC 1 cut(s) 79
MseI TTAA 2 cut(s) 110, 205
MwoI GCNNNNNNNGC 1 cut(s) 86
NdeII GATC 1 cut(s) 43
PsuI RGATCY 1 cut(s) 43
SaqAI TTAA 2 cut(s) 110, 205
Sau3AI GATC 1 cut(s) 43
SetI ASST 1 cut(s) 106
SgeI CNNG 3 cut(s) 24, 103, 113
Sse9I AATT 3 cut(s) 116, 132, 180
TaaI ACNGT 1 cut(s) 145
TasI AATT 3 cut(s) 116, 132, 180
Tru1I TTAA 2 cut(s) 110, 205
Tru9I TTAA 2 cut(s) 110, 205
XapI RAATTY 2 cut(s) 116, 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.