RchiOBHm_Chr5g0059171

UPF0695 membrane protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
64049478 .. 64053087
3610 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33577

Sequence Viewer

Length: 234 bp
ATGATGCTGGTGTTCAGTTTACACTGCAAGGCAAGTACAGAAAGAATACCAAAATTGTTGGAGTATGGTTCATGTATGACTCATCTAGCCTTCCTTGGCATTCTTAGGGTCTTAACGAGATATCTACTGCAAAAATTGGTTGGCCCTGGAGTTGCTGGTTGGATCGTTCTTGATGGGGTGGTGCGGTGTTGTTTTCAAACCAGATATCATATAGGTTTACATAATTGGAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.83

Weight (kDa)

9.62

Isoelectric Point (pI)

31.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 184
AclWI GGATC 1 cut(s) 170
AfaI GTAC 1 cut(s) 37
AgsI TTSAA 1 cut(s) 197
AjnI CCWGG 1 cut(s) 145
AlwI GGATC 1 cut(s) 170
AoxI GGCC 1 cut(s) 142
AspS9I GGNCC 1 cut(s) 143
BccI CCATC 1 cut(s) 167
BciT130I CCWGG 1 cut(s) 147
BfaI CTAG 1 cut(s) 86
Bme1390I CCNGG 1 cut(s) 147
BmgT120I GGNCC 1 cut(s) 143
BmrFI CCNGG 1 cut(s) 147
BpmI CTGGAG 1 cut(s) 168
BsaJI CCNNGG 2 cut(s) 94, 145
BseBI CCWGG 1 cut(s) 147
BseDI CCNNGG 2 cut(s) 94, 145
BshFI GGCC 1 cut(s) 144
BsmI GAATGC 1 cut(s) 99
BsnI GGCC 1 cut(s) 144
Bsp143I GATC 1 cut(s) 162
BspACI CCGC 1 cut(s) 184
BspANI GGCC 1 cut(s) 144
BspPI GGATC 1 cut(s) 170
BssECI CCNNGG 2 cut(s) 94, 145
BssMI GATC 1 cut(s) 162
BssT1I CCWWGG 1 cut(s) 94
Bst2UI CCWGG 1 cut(s) 147
BstDEI CTNAG 1 cut(s) 104
BstKTI GATC 1 cut(s) 165
BstMBI GATC 1 cut(s) 162
BstNI CCWGG 1 cut(s) 147
BstSCI CCNGG 1 cut(s) 145
BsuRI GGCC 1 cut(s) 144
BtsI GCAGTG 1 cut(s) 22
BtsIMutI CAGTG 1 cut(s) 22
Cfr13I GGNCC 1 cut(s) 143
Csp6I GTAC 1 cut(s) 36
CviAII CATG 1 cut(s) 72
CviJI RGCY 2 cut(s) 89, 144
CviKI_1 RGCY 2 cut(s) 89, 144
CviQI GTAC 1 cut(s) 36
DdeI CTNAG 1 cut(s) 104
DpnI GATC 1 cut(s) 164
DpnII GATC 1 cut(s) 162
Eco130I CCWWGG 1 cut(s) 94
Eco32I GATATC 2 cut(s) 122, 206
EcoRII CCWGG 1 cut(s) 145
EcoRV GATATC 2 cut(s) 122, 206
EcoT14I CCWWGG 1 cut(s) 94
ErhI CCWWGG 1 cut(s) 94
FaeI CATG 1 cut(s) 75
FaiI YATR 6 cut(s) 66, 73, 77, 210, 212, 222
FatI CATG 1 cut(s) 71
FspBI CTAG 1 cut(s) 86
GsuI CTGGAG 1 cut(s) 168
HaeIII GGCC 1 cut(s) 144
Hin1II CATG 1 cut(s) 75
HinfI GANTC 1 cut(s) 79
Hpy166II GTNNAC 2 cut(s) 20, 218
Hpy188III TCNNGA 1 cut(s) 170
Hpy8I GTNNAC 2 cut(s) 20, 218
HpyAV CCTTC 1 cut(s) 100
HpyCH4V TGCA 2 cut(s) 27, 130
HpyF3I CTNAG 1 cut(s) 104
Hsp92II CATG 1 cut(s) 75
Kzo9I GATC 1 cut(s) 162
LpnPI CCDG 4 cut(s) 132, 141, 159, 214
MaeI CTAG 1 cut(s) 86
MalI GATC 1 cut(s) 164
MboI GATC 1 cut(s) 162
MluCI AATT 3 cut(s) 53, 134, 223
MlyI GAGTC 1 cut(s) 73
MmeI TCCRAC 2 cut(s) 39, 140
MnlI CCTC 1 cut(s) 222
MseI TTAA 1 cut(s) 113
MspR9I CCNGG 1 cut(s) 147
Mva1269I GAATGC 1 cut(s) 99
MvaI CCWGG 1 cut(s) 147
NdeII GATC 1 cut(s) 162
NlaIII CATG 1 cut(s) 75
PctI GAATGC 1 cut(s) 99
PleI GAGTC 1 cut(s) 73
PpsI GAGTC 1 cut(s) 73
Psp6I CCWGG 1 cut(s) 145
PspGI CCWGG 1 cut(s) 145
PspPI GGNCC 1 cut(s) 143
RsaI GTAC 1 cut(s) 37
RsaNI GTAC 1 cut(s) 36
SaqAI TTAA 1 cut(s) 113
Sau3AI GATC 1 cut(s) 162
Sau96I GGNCC 1 cut(s) 143
SchI GAGTC 1 cut(s) 73
ScrFI CCNGG 1 cut(s) 147
SetI ASST 2 cut(s) 217, 233
Sse9I AATT 3 cut(s) 53, 134, 223
SsiI CCGC 1 cut(s) 184
SspMI CTAG 1 cut(s) 86
StyD4I CCNGG 1 cut(s) 145
StyI CCWWGG 1 cut(s) 94
TasI AATT 3 cut(s) 53, 134, 223
TatI WGTACW 1 cut(s) 35
Tru1I TTAA 1 cut(s) 113
Tru9I TTAA 1 cut(s) 113
TscAI CASTG 1 cut(s) 29
TspDTI ATGAA 1 cut(s) 60
TspRI CASTG 1 cut(s) 29
XspI CTAG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.