Rh7BG416300

UPF0695 membrane protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
46991689 .. 46992972
1284 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG416300.1

Sequence Viewer

Length: 264 bp
ATGATGCTAGTGTTCAGTTTACACTGCAAGGCAAGTACAGAAAGAATACCAAAATTGTTGGAGTATGGTTCATGTATGACTCATCTAGCCTTCTTTGGCATTCTTAGGGTCTTAACGAGATATCTACTGCAAAAATTGGTTGGCCCTGGAGTTGCTGGTATGACAAGTGACCAAACAATGCTTTACCTTGATCTTCCTTCTAATATGGTTGGCTTGTTCTTGATGGGGTGGTGCGGTGTTGTTTTCAAACCAGATATCATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.73

Weight (kDa)

8.55

Isoelectric Point (pI)

22.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 234
AfaI GTAC 1 cut(s) 37
AgsI TTSAA 1 cut(s) 247
AjnI CCWGG 1 cut(s) 145
AoxI GGCC 1 cut(s) 142
AspS9I GGNCC 1 cut(s) 143
BccI CCATC 1 cut(s) 217
BciT130I CCWGG 1 cut(s) 147
BfaI CTAG 2 cut(s) 8, 86
Bme1390I CCNGG 1 cut(s) 147
BmgT120I GGNCC 1 cut(s) 143
BmrFI CCNGG 1 cut(s) 147
BpmI CTGGAG 1 cut(s) 168
BsaJI CCNNGG 1 cut(s) 145
BseBI CCWGG 1 cut(s) 147
BseDI CCNNGG 1 cut(s) 145
BshFI GGCC 1 cut(s) 144
BsmI GAATGC 1 cut(s) 99
BsnI GGCC 1 cut(s) 144
Bsp143I GATC 1 cut(s) 190
BspACI CCGC 1 cut(s) 234
BspANI GGCC 1 cut(s) 144
BssECI CCNNGG 1 cut(s) 145
BssMI GATC 1 cut(s) 190
Bst2UI CCWGG 1 cut(s) 147
BstDEI CTNAG 1 cut(s) 104
BstKTI GATC 1 cut(s) 193
BstMBI GATC 1 cut(s) 190
BstNI CCWGG 1 cut(s) 147
BstSCI CCNGG 1 cut(s) 145
BsuRI GGCC 1 cut(s) 144
BtsI GCAGTG 1 cut(s) 22
BtsIMutI CAGTG 1 cut(s) 22
Cfr13I GGNCC 1 cut(s) 143
Csp6I GTAC 1 cut(s) 36
CviAII CATG 1 cut(s) 72
CviJI RGCY 3 cut(s) 89, 144, 213
CviKI_1 RGCY 3 cut(s) 89, 144, 213
CviQI GTAC 1 cut(s) 36
DdeI CTNAG 1 cut(s) 104
DpnI GATC 1 cut(s) 192
DpnII GATC 1 cut(s) 190
Eco32I GATATC 2 cut(s) 122, 256
EcoRII CCWGG 1 cut(s) 145
EcoRV GATATC 2 cut(s) 122, 256
FaeI CATG 1 cut(s) 75
FaiI YATR 7 cut(s) 66, 73, 77, 161, 206, 260, 262
FatI CATG 1 cut(s) 71
FspBI CTAG 2 cut(s) 8, 86
GsuI CTGGAG 1 cut(s) 168
HaeIII GGCC 1 cut(s) 144
Hin1II CATG 1 cut(s) 75
HinfI GANTC 1 cut(s) 79
Hpy166II GTNNAC 1 cut(s) 20
Hpy188III TCNNGA 1 cut(s) 220
Hpy8I GTNNAC 1 cut(s) 20
HpyAV CCTTC 2 cut(s) 100, 207
HpyCH4V TGCA 2 cut(s) 27, 130
HpyF3I CTNAG 1 cut(s) 104
Hsp92II CATG 1 cut(s) 75
Kzo9I GATC 1 cut(s) 190
LpnPI CCDG 3 cut(s) 132, 141, 159
MaeI CTAG 2 cut(s) 8, 86
MaeIII GTNAC 1 cut(s) 167
MalI GATC 1 cut(s) 192
MboI GATC 1 cut(s) 190
MboII GAAGA 1 cut(s) 185
MluCI AATT 2 cut(s) 53, 134
MlyI GAGTC 1 cut(s) 73
MmeI TCCRAC 1 cut(s) 39
MseI TTAA 1 cut(s) 113
MspR9I CCNGG 1 cut(s) 147
Mva1269I GAATGC 1 cut(s) 99
MvaI CCWGG 1 cut(s) 147
NdeII GATC 1 cut(s) 190
NlaIII CATG 1 cut(s) 75
NmuCI GTSAC 1 cut(s) 167
PctI GAATGC 1 cut(s) 99
PleI GAGTC 1 cut(s) 73
PpsI GAGTC 1 cut(s) 73
Psp6I CCWGG 1 cut(s) 145
PspGI CCWGG 1 cut(s) 145
PspPI GGNCC 1 cut(s) 143
RsaI GTAC 1 cut(s) 37
RsaNI GTAC 1 cut(s) 36
SaqAI TTAA 1 cut(s) 113
Sau3AI GATC 1 cut(s) 190
Sau96I GGNCC 1 cut(s) 143
SchI GAGTC 1 cut(s) 73
ScrFI CCNGG 1 cut(s) 147
SetI ASST 1 cut(s) 189
Sse9I AATT 2 cut(s) 53, 134
SsiI CCGC 1 cut(s) 234
SspMI CTAG 2 cut(s) 8, 86
StyD4I CCNGG 1 cut(s) 145
TasI AATT 2 cut(s) 53, 134
TatI WGTACW 1 cut(s) 35
Tru1I TTAA 1 cut(s) 113
Tru9I TTAA 1 cut(s) 113
TscAI CASTG 1 cut(s) 29
TseFI GTSAC 1 cut(s) 167
Tsp45I GTSAC 1 cut(s) 167
TspDTI ATGAA 1 cut(s) 60
TspRI CASTG 1 cut(s) 29
XspI CTAG 2 cut(s) 8, 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.