RchiOBHm_Chr6g0263121

deSI-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0002011
Physical Location & Seq
Reverse (-)
17920839 .. 17925534
4696 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23598

Sequence Viewer

Length: 744 bp
ATGAAATCAGGACCAAAGGATGGCTGGCACTCTATCATGCCTCTATGTTTGAGAGGGAAATCAGCTTCACGTTTTTGCATGTTTCCAAATTTGAAGGCAGCAGACTGCAGTCCAGGAAACGTACCTGTCTATCTAAATGTTTATGACTTGACACCTGCAAATGGCTATGTTTATTGGGCAGGTGTTGGTATCTTTCACTCTGGGGTGGAAGTCTATGGTGTAGAATATGCCTTTGGAGCCCATGAGTACTCATCAAGTGGTGTCTTTGAGGTTGAACCTCGACAATGCCCTGGCTTCAAGTTTAGAAGGTCAATTTTCATTGGCACAACATGCTTGGATCCTTTCCAGGTTAGAGAGTTCATGGAGCGTCAATCTGCAAACTACAATGGTGACACATACCACTTGATTGTTAAGAACTGCAACCATTTCTGTCAAGATATATGCTATAAGCTGACTGGAAAATCGACACCAAAATGGGTCAATCGCCTCGCAAAAATAGGTTCATTTTGCAACTGTATACTCCCAGATGCCCTTAAGTCGACCACTGTTCCACATGACCCCAATTTCCCAGGATATGAAAGTGAAAAAAAGAGACTAAGAAGTGCCTTCACTTGCTTGTCATCAATCTCAATGCCTCAGAGGGAAGTATCGATGTCGTCATTATTTCTACATTCGCATTATAAAGGCTGCCTACCACCATGGGAGTTTAAAAGGTCTAGAAGTGGCTCATTGAAAAAAGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Peptidase_C97

Protein Analysis

247

Amino Acids

27.82

Weight (kDa)

9.11

Isoelectric Point (pI)

45.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Peptidase_C97 PF05903 42 - 177 7.2e-50 PPPDE putative peptidase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 681
AarI CACCTGC 2 cut(s) 163, 170
Acc36I ACCTGC 2 cut(s) 163, 170
AccB7I CCANNNNNTGG 1 cut(s) 20
AccI GTMKAC 2 cut(s) 517, 539
AclWI GGATC 2 cut(s) 332, 345
AcsI RAATTY 1 cut(s) 88
AfaI GTAC 2 cut(s) 123, 248
AfiI CCNNNNNNNGG 2 cut(s) 20, 161
AflII CTTAAG 1 cut(s) 533
AgsI TTSAA 4 cut(s) 94, 275, 298, 733
AjnI CCWGG 4 cut(s) 112, 289, 345, 568
AjuI GAANNNNNNNTTGG 2 cut(s) 216, 248
AluBI AGCT 2 cut(s) 65, 451
AluI AGCT 2 cut(s) 65, 451
Alw26I GTCTC 1 cut(s) 586
AlwI GGATC 2 cut(s) 332, 345
ApeKI GCWGC 2 cut(s) 98, 687
ApoI RAATTY 1 cut(s) 88
AspS9I GGNCC 1 cut(s) 11
AsuHPI GGTGA 1 cut(s) 401
AvaII GGWCC 1 cut(s) 11
BamHI GGATCC 1 cut(s) 337
BanII GRGCYC 1 cut(s) 241
BbvI GCAGC 2 cut(s) 110, 674
BccI CCATC 1 cut(s) 14
BciT130I CCWGG 4 cut(s) 114, 291, 347, 570
BcoDI GTCTC 1 cut(s) 586
BfaI CTAG 1 cut(s) 717
BfmI CTRYAG 1 cut(s) 106
BfrI CTTAAG 1 cut(s) 533
BfuAI ACCTGC 2 cut(s) 163, 170
BisI GCNGC 2 cut(s) 99, 688
BlsI GCNGC 2 cut(s) 100, 689
BmcAI AGTACT 1 cut(s) 248
Bme1390I CCNGG 4 cut(s) 114, 291, 347, 570
Bme18I GGWCC 1 cut(s) 11
BmgT120I GGNCC 1 cut(s) 11
BmiI GGNNCC 2 cut(s) 238, 339
BmrFI CCNGG 4 cut(s) 114, 291, 347, 570
BmsI GCATC 1 cut(s) 517
BoxI GACNNNNGTC 1 cut(s) 108
Bsa29I ATCGAT 1 cut(s) 650
BsaJI CCNNGG 3 cut(s) 289, 568, 698
Bsc4I CCNNNNNNNGG 2 cut(s) 20, 161
Bse1I ACTGG 1 cut(s) 460
BseBI CCWGG 4 cut(s) 114, 291, 347, 570
BseCI ATCGAT 1 cut(s) 650
BseDI CCNNGG 3 cut(s) 289, 568, 698
BseGI GGATG 1 cut(s) 25
BseLI CCNNNNNNNGG 2 cut(s) 20, 161
BseMII CTCAG 1 cut(s) 650
BseNI ACTGG 1 cut(s) 460
BseXI GCAGC 2 cut(s) 110, 674
BshVI ATCGAT 1 cut(s) 650
BslI CCNNNNNNNGG 2 cut(s) 20, 161
BsmAI GTCTC 1 cut(s) 586
Bsp1286I GDGCHC 1 cut(s) 241
Bsp143I GATC 1 cut(s) 337
Bsp19I CCATGG 1 cut(s) 698
BspCNI CTCAG 1 cut(s) 649
BspDI ATCGAT 1 cut(s) 650
BspLI GGNNCC 2 cut(s) 238, 339
BspMAI CTGCAG 1 cut(s) 110
BspMI ACCTGC 2 cut(s) 163, 170
BspPI GGATC 2 cut(s) 332, 345
BspTI CTTAAG 1 cut(s) 533
BsrI ACTGG 1 cut(s) 460
BssECI CCNNGG 3 cut(s) 289, 568, 698
BssMI GATC 1 cut(s) 337
BssNAI GTATAC 1 cut(s) 518
BssT1I CCWWGG 1 cut(s) 698
Bst1107I GTATAC 1 cut(s) 518
Bst2UI CCWGG 4 cut(s) 114, 291, 347, 570
Bst4CI ACNGT 2 cut(s) 515, 547
BstAFI CTTAAG 1 cut(s) 533
BstAPI GCANNNNNTGC 1 cut(s) 330
BstC8I GCNNGC 1 cut(s) 26
BstDEI CTNAG 2 cut(s) 596, 636
BstDSI CCRYGG 1 cut(s) 698
BstF5I GGATG 1 cut(s) 25
BstKTI GATC 1 cut(s) 340
BstMAI GTCTC 1 cut(s) 586
BstMBI GATC 1 cut(s) 337
BstMWI GCNNNNNNNGC 2 cut(s) 236, 330
BstNI CCWGG 4 cut(s) 114, 291, 347, 570
BstNSI RCATGY 2 cut(s) 82, 333
BstPAI GACNNNNGTC 1 cut(s) 108
BstSCI CCNGG 4 cut(s) 112, 289, 345, 568
BstSFI CTRYAG 1 cut(s) 106
BstV1I GCAGC 2 cut(s) 110, 674
BstX2I RGATCY 1 cut(s) 337
BstYI RGATCY 1 cut(s) 337
BstZ17I GTATAC 1 cut(s) 518
Bsu15I ATCGAT 1 cut(s) 650
BsuTUI ATCGAT 1 cut(s) 650
BtgI CCRYGG 1 cut(s) 698
BtsCI GGATG 1 cut(s) 25
BtsIMutI CAGTG 1 cut(s) 543
BveI ACCTGC 2 cut(s) 163, 170
Cac8I GCNNGC 1 cut(s) 26
Cfr13I GGNCC 1 cut(s) 11
ClaI ATCGAT 1 cut(s) 650
CseI GACGC 1 cut(s) 356
Csp6I GTAC 2 cut(s) 122, 247
CviAII CATG 7 cut(s) 37, 79, 242, 330, 361, 554, 699
CviJI RGCY 8 cut(s) 24, 65, 165, 239, 294, 451, 687, 726
CviKI_1 RGCY 8 cut(s) 24, 65, 165, 239, 294, 451, 687, 726
CviQI GTAC 2 cut(s) 122, 247
DdeI CTNAG 2 cut(s) 596, 636
DpnI GATC 1 cut(s) 339
DpnII GATC 1 cut(s) 337
DraI TTTAAA 1 cut(s) 709
Eco130I CCWWGG 1 cut(s) 698
Eco24I GRGCYC 1 cut(s) 241
Eco47I GGWCC 1 cut(s) 11
EcoRII CCWGG 4 cut(s) 112, 289, 345, 568
EcoT14I CCWWGG 1 cut(s) 698
EcoT38I GRGCYC 1 cut(s) 241
ErhI CCWWGG 1 cut(s) 698
FaeI CATG 7 cut(s) 40, 82, 245, 333, 364, 557, 702
FatI CATG 7 cut(s) 36, 78, 241, 329, 360, 553, 698
FblI GTMKAC 2 cut(s) 517, 539
Fnu4HI GCNGC 2 cut(s) 99, 688
FokI GGATG 1 cut(s) 32
FriOI GRGCYC 1 cut(s) 241
Fsp4HI GCNGC 2 cut(s) 99, 688
FspBI CTAG 1 cut(s) 717
GluI GCNGC 2 cut(s) 99, 688
HgaI GACGC 1 cut(s) 356
Hin1II CATG 7 cut(s) 40, 82, 245, 333, 364, 557, 702
HincII GTYRAC 1 cut(s) 540
HindII GTYRAC 1 cut(s) 540
HphI GGTGA 1 cut(s) 401
Hpy166II GTNNAC 2 cut(s) 518, 540
Hpy188I TCNGA 1 cut(s) 639
Hpy188III TCNNGA 3 cut(s) 9, 434, 717
Hpy8I GTNNAC 2 cut(s) 518, 540
HpyAV CCTTC 3 cut(s) 88, 300, 616
HpyCH4III ACNGT 2 cut(s) 515, 547
HpyCH4IV ACGT 2 cut(s) 70, 120
HpyCH4V TGCA 6 cut(s) 78, 108, 158, 377, 420, 510
HpyF10VI GCNNNNNNNGC 2 cut(s) 236, 330
HpyF3I CTNAG 2 cut(s) 596, 636
HpySE526I ACGT 2 cut(s) 70, 120
Hsp92II CATG 7 cut(s) 40, 82, 245, 333, 364, 557, 702
Kzo9I GATC 1 cut(s) 337
LmnI GCTCC 2 cut(s) 236, 364
Lsp1109I GCAGC 2 cut(s) 110, 674
LweI GCATC 1 cut(s) 517
MaeI CTAG 1 cut(s) 717
MaeII ACGT 2 cut(s) 70, 120
MaeIII GTNAC 1 cut(s) 389
MalI GATC 1 cut(s) 339
MboI GATC 1 cut(s) 337
MflI RGATCY 1 cut(s) 337
MhlI GDGCHC 1 cut(s) 241
MluCI AATT 3 cut(s) 88, 312, 562
MnlI CCTC 7 cut(s) 47, 51, 262, 288, 497, 633, 645
MseI TTAA 3 cut(s) 411, 534, 708
MslI CAYNNNNRTG 1 cut(s) 472
MspCI CTTAAG 1 cut(s) 533
MspR9I CCNGG 4 cut(s) 114, 291, 347, 570
MvaI CCWGG 4 cut(s) 114, 291, 347, 570
MwoI GCNNNNNNNGC 2 cut(s) 236, 330
NcoI CCATGG 1 cut(s) 698
NdeII GATC 1 cut(s) 337
NlaIII CATG 7 cut(s) 40, 82, 245, 333, 364, 557, 702
NlaIV GGNNCC 2 cut(s) 238, 339
NmuCI GTSAC 1 cut(s) 389
NspI RCATGY 2 cut(s) 82, 333
PaqCI CACCTGC 2 cut(s) 163, 170
PflMI CCANNNNNTGG 1 cut(s) 20
PfoI TCCNGGA 1 cut(s) 112
PkrI GCNGC 2 cut(s) 100, 689
PshAI GACNNNNGTC 1 cut(s) 108
PsiI TTATAA 1 cut(s) 681
Psp6I CCWGG 4 cut(s) 112, 289, 345, 568
PspGI CCWGG 4 cut(s) 112, 289, 345, 568
PspN4I GGNNCC 2 cut(s) 238, 339
PspPI GGNCC 1 cut(s) 11
PstI CTGCAG 1 cut(s) 110
PsuI RGATCY 1 cut(s) 337
RsaI GTAC 2 cut(s) 123, 248
RsaNI GTAC 2 cut(s) 122, 247
RseI CAYNNNNRTG 1 cut(s) 472
SalI GTCGAC 1 cut(s) 538
SaqAI TTAA 3 cut(s) 411, 534, 708
SatI GCNGC 2 cut(s) 99, 688
Sau3AI GATC 1 cut(s) 337
Sau96I GGNCC 1 cut(s) 11
ScaI AGTACT 1 cut(s) 248
ScrFI CCNGG 4 cut(s) 114, 291, 347, 570
SduI GDGCHC 1 cut(s) 241
SfaNI GCATC 1 cut(s) 517
SfcI CTRYAG 1 cut(s) 106
SinI GGWCC 1 cut(s) 11
SmiMI CAYNNNNRTG 1 cut(s) 472
SmlI CTYRAG 1 cut(s) 533
SmoI CTYRAG 1 cut(s) 533
Sse9I AATT 3 cut(s) 88, 312, 562
SspMI CTAG 1 cut(s) 717
StyD4I CCNGG 4 cut(s) 112, 289, 345, 568
StyI CCWWGG 1 cut(s) 698
TaaI ACNGT 2 cut(s) 515, 547
TaiI ACGT 2 cut(s) 73, 123
TaqI TCGA 4 cut(s) 280, 464, 539, 650
TasI AATT 3 cut(s) 88, 312, 562
TatI WGTACW 1 cut(s) 246
Tru1I TTAA 3 cut(s) 411, 534, 708
Tru9I TTAA 3 cut(s) 411, 534, 708
TscAI CASTG 1 cut(s) 550
TseFI GTSAC 1 cut(s) 389
TseI GCWGC 2 cut(s) 98, 687
Tsp45I GTSAC 1 cut(s) 389
TspDTI ATGAA 5 cut(s) 17, 307, 349, 492, 591
TspRI CASTG 1 cut(s) 550
Van91I CCANNNNNTGG 1 cut(s) 20
Vha464I CTTAAG 1 cut(s) 533
VpaK11BI GGWCC 1 cut(s) 11
XapI RAATTY 1 cut(s) 88
XbaI TCTAGA 1 cut(s) 716
XceI RCATGY 2 cut(s) 82, 333
XcmI CCANNNNNNNNNTGG 1 cut(s) 21
XmiI GTMKAC 2 cut(s) 517, 539
XspI CTAG 1 cut(s) 717
ZrmI AGTACT 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.