Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002146.1

Orthogroup ID

OG0002011

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 3246

Gene Structure 3246 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002146.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 745 bp

aatgaaatcaggaccaaaggatggctggcactctatcatgcctctatgtttgagagggaaatcagcttcacgtttttgcatatttccaaatttgaaggcagcagactgcagtccaggaaacgtacctgtctatctaaatgtttatgacttgacacctgcaaatggctatgtttattgggcaggtgttggtatctttcactctggggtggaagtctatggtgtagaatatgcctttggagcccatgagtactcatcaagtggtgtctttgaggttgaacctcgacaatgccctggcttcaagtttagaaggtcaattttcatcggcacaacatgcttggatcctttccaggttagagagttcatggagcgtcaatctgcaaactacaatggtgacacatatcacttgattgttaagaactgcaaccatttctgtcaagatatatgttataagctgactggaaaatcgacaccaaaatgggtcaatcgcctcgcaaaaataggttcattttgcaactgtatactcccagatgcccttaagtcaaccactgttccacatgaccccaatttcccaggatatgaaagtgaaaaaaagagactaagaagtgccttcacttgcttgtcatcaatctcaatgcctcagagggaagtatcaatgtcgtcattatttctacattcacactataaaggctgcctaccaccgtgggagtttaaaaggtctagaagtggctcattgaaaaaagggtga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Peptidase_C97

Protein Analysis

247

Amino Acids

27.8

Weight (kDa)

9.11

Isoelectric Point (pI)

44.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002011)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G47740 AT1G47740 AT1G47740
fragaria_vesca	FvH4_2g08250 FvH4_2g08250 FvH4_2g08250 FvH4_2g08250 FvH4_2g08250 FvH4_2g40100 FvH4_2g40100 FvH4_2g40100 FvH4_2g40100
malus_domestica	MD05G1070300.v1.1 MD08G1032400.v1.1 MD10G1081000.v1.1 MD15G1029100.v1.1
prunus_persica	Prupe.1G382300_v2.0.a1 Prupe.1G382300_v2.0.a1 Prupe.8G102300_v2.0.a1 Prupe.8G102300_v2.0.a1
pyrus_communis	pycom05g06050 pycom08g02570 pycom10g06410 pycom15g02580
rosa_chinensis	RchiOBHm_Chr6g0263121 RchiOBHm_Chr6g0300641
rosa_laevigata	RLG00000014372
rosa_multiflora	Rmu_sc0002146.1_g000001 Rmu_sc0010560.1_g000008 Rmu_sc0028840.1_g000001
rosa_roxburghii	Rroxscaffold_7G00167550
rosa_rugosa	Rorug06G0003700 Rorug06G0003700 Rorug06G0298200
rosa_samantha	Rh6AG122700 Rh6AG410700 Rh6BG117700 Rh6BG417900 Rh6CG116000 Rh6CG425400 Rh6DG104500 Rh6DG410800
rosa_wichuraiana	Rw0G002210 Rw6G010540 Rw6G035930

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	448
AarI	CACCTGC	2 cut(s)	164, 171
Acc36I	ACCTGC	2 cut(s)	164, 171
AccB7I	CCANNNNNTGG	1 cut(s)	21
AccI	GTMKAC	1 cut(s)	518
AclWI	GGATC	2 cut(s)	333, 346
AcsI	RAATTY	1 cut(s)	89
AfaI	GTAC	2 cut(s)	124, 249
AfiI	CCNNNNNNNGG	2 cut(s)	21, 162
AflII	CTTAAG	1 cut(s)	534
AgsI	TTSAA	4 cut(s)	95, 276, 299, 734
AjnI	CCWGG	4 cut(s)	113, 290, 346, 569
AjuI	GAANNNNNNNTTGG	2 cut(s)	217, 249
AluBI	AGCT	2 cut(s)	66, 452
AluI	AGCT	2 cut(s)	66, 452
Alw26I	GTCTC	1 cut(s)	587
AlwI	GGATC	2 cut(s)	333, 346
ApeKI	GCWGC	2 cut(s)	99, 688
ApoI	RAATTY	1 cut(s)	89
AspS9I	GGNCC	1 cut(s)	12
AsuHPI	GGTGA	1 cut(s)	402
AvaII	GGWCC	1 cut(s)	12
BamHI	GGATCC	1 cut(s)	338
BanII	GRGCYC	1 cut(s)	242
BbvI	GCAGC	2 cut(s)	111, 675
BccI	CCATC	1 cut(s)	15
BciT130I	CCWGG	4 cut(s)	115, 292, 348, 571
BcoDI	GTCTC	1 cut(s)	587
BfaI	CTAG	1 cut(s)	718
BfmI	CTRYAG	1 cut(s)	107
BfrI	CTTAAG	1 cut(s)	534
BfuAI	ACCTGC	2 cut(s)	164, 171
BisI	GCNGC	2 cut(s)	100, 689
BlsI	GCNGC	2 cut(s)	101, 690
BmcAI	AGTACT	1 cut(s)	249
Bme1390I	CCNGG	4 cut(s)	115, 292, 348, 571
Bme18I	GGWCC	1 cut(s)	12
BmgT120I	GGNCC	1 cut(s)	12
BmiI	GGNNCC	2 cut(s)	239, 340
BmrFI	CCNGG	4 cut(s)	115, 292, 348, 571
BmsI	GCATC	1 cut(s)	518
BoxI	GACNNNNGTC	1 cut(s)	109
BsaJI	CCNNGG	3 cut(s)	290, 569, 699
Bsc4I	CCNNNNNNNGG	2 cut(s)	21, 162
Bse1I	ACTGG	1 cut(s)	461
BseBI	CCWGG	4 cut(s)	115, 292, 348, 571
BseDI	CCNNGG	3 cut(s)	290, 569, 699
BseGI	GGATG	1 cut(s)	26
BseLI	CCNNNNNNNGG	2 cut(s)	21, 162
BseMII	CTCAG	1 cut(s)	651
BseNI	ACTGG	1 cut(s)	461
BseXI	GCAGC	2 cut(s)	111, 675
BslI	CCNNNNNNNGG	2 cut(s)	21, 162
BsmAI	GTCTC	1 cut(s)	587
Bsp1286I	GDGCHC	1 cut(s)	242
Bsp143I	GATC	1 cut(s)	338
BspCNI	CTCAG	1 cut(s)	650
BspLI	GGNNCC	2 cut(s)	239, 340
BspMAI	CTGCAG	1 cut(s)	111
BspMI	ACCTGC	2 cut(s)	164, 171
BspPI	GGATC	2 cut(s)	333, 346
BspTI	CTTAAG	1 cut(s)	534
BsrI	ACTGG	1 cut(s)	461
BssECI	CCNNGG	3 cut(s)	290, 569, 699
BssMI	GATC	1 cut(s)	338
BssNAI	GTATAC	1 cut(s)	519
Bst1107I	GTATAC	1 cut(s)	519
Bst2UI	CCWGG	4 cut(s)	115, 292, 348, 571
Bst4CI	ACNGT	3 cut(s)	516, 548, 700
BstAFI	CTTAAG	1 cut(s)	534
BstAPI	GCANNNNNTGC	1 cut(s)	331
BstC8I	GCNNGC	1 cut(s)	27
BstDEI	CTNAG	2 cut(s)	597, 637
BstDSI	CCRYGG	1 cut(s)	699
BstF5I	GGATG	1 cut(s)	26
BstKTI	GATC	1 cut(s)	341
BstMAI	GTCTC	1 cut(s)	587
BstMBI	GATC	1 cut(s)	338
BstMWI	GCNNNNNNNGC	2 cut(s)	237, 331
BstNI	CCWGG	4 cut(s)	115, 292, 348, 571
BstNSI	RCATGY	1 cut(s)	334
BstPAI	GACNNNNGTC	1 cut(s)	109
BstSCI	CCNGG	4 cut(s)	113, 290, 346, 569
BstSFI	CTRYAG	1 cut(s)	107
BstV1I	GCAGC	2 cut(s)	111, 675
BstX2I	RGATCY	1 cut(s)	338
BstYI	RGATCY	1 cut(s)	338
BstZ17I	GTATAC	1 cut(s)	519
BtgI	CCRYGG	1 cut(s)	699
BtsCI	GGATG	1 cut(s)	26
BtsIMutI	CAGTG	1 cut(s)	544
BveI	ACCTGC	2 cut(s)	164, 171
Cac8I	GCNNGC	1 cut(s)	27
Cfr13I	GGNCC	1 cut(s)	12
CseI	GACGC	1 cut(s)	357
Csp6I	GTAC	2 cut(s)	123, 248
CviAII	CATG	5 cut(s)	38, 243, 331, 362, 555
CviJI	RGCY	8 cut(s)	25, 66, 166, 240, 295, 452, 688, 727
CviKI_1	RGCY	8 cut(s)	25, 66, 166, 240, 295, 452, 688, 727
CviQI	GTAC	2 cut(s)	123, 248
DdeI	CTNAG	2 cut(s)	597, 637
DpnI	GATC	1 cut(s)	340
DpnII	GATC	1 cut(s)	338
DraI	TTTAAA	1 cut(s)	710
Eco24I	GRGCYC	1 cut(s)	242
Eco47I	GGWCC	1 cut(s)	12
EcoRII	CCWGG	4 cut(s)	113, 290, 346, 569
EcoT38I	GRGCYC	1 cut(s)	242
FaeI	CATG	5 cut(s)	41, 246, 334, 365, 558
FatI	CATG	5 cut(s)	37, 242, 330, 361, 554
FblI	GTMKAC	1 cut(s)	518
Fnu4HI	GCNGC	2 cut(s)	100, 689
FokI	GGATG	1 cut(s)	33
FriOI	GRGCYC	1 cut(s)	242
Fsp4HI	GCNGC	2 cut(s)	100, 689
FspBI	CTAG	1 cut(s)	718
GluI	GCNGC	2 cut(s)	100, 689
HgaI	GACGC	1 cut(s)	357
Hin1II	CATG	5 cut(s)	41, 246, 334, 365, 558
HincII	GTYRAC	1 cut(s)	541
HindII	GTYRAC	1 cut(s)	541
HphI	GGTGA	1 cut(s)	402
Hpy166II	GTNNAC	2 cut(s)	519, 541
Hpy188I	TCNGA	1 cut(s)	640
Hpy188III	TCNNGA	3 cut(s)	10, 435, 718
Hpy8I	GTNNAC	2 cut(s)	519, 541
HpyAV	CCTTC	3 cut(s)	89, 301, 617
HpyCH4III	ACNGT	3 cut(s)	516, 548, 700
HpyCH4IV	ACGT	2 cut(s)	71, 121
HpyCH4V	TGCA	6 cut(s)	79, 109, 159, 378, 421, 511
HpyF10VI	GCNNNNNNNGC	2 cut(s)	237, 331
HpyF3I	CTNAG	2 cut(s)	597, 637
HpySE526I	ACGT	2 cut(s)	71, 121
Hsp92II	CATG	5 cut(s)	41, 246, 334, 365, 558
Kzo9I	GATC	1 cut(s)	338
LmnI	GCTCC	2 cut(s)	237, 365
Lsp1109I	GCAGC	2 cut(s)	111, 675
LweI	GCATC	1 cut(s)	518
MaeI	CTAG	1 cut(s)	718
MaeII	ACGT	2 cut(s)	71, 121
MaeIII	GTNAC	1 cut(s)	390
MalI	GATC	1 cut(s)	340
MboI	GATC	1 cut(s)	338
MflI	RGATCY	1 cut(s)	338
MhlI	GDGCHC	1 cut(s)	242
MluCI	AATT	3 cut(s)	89, 313, 563
MnlI	CCTC	7 cut(s)	48, 52, 263, 289, 498, 634, 646
MseI	TTAA	3 cut(s)	412, 535, 709
MslI	CAYNNNNRTG	1 cut(s)	473
MspCI	CTTAAG	1 cut(s)	534
MspR9I	CCNGG	4 cut(s)	115, 292, 348, 571
MvaI	CCWGG	4 cut(s)	115, 292, 348, 571
MwoI	GCNNNNNNNGC	2 cut(s)	237, 331
NdeII	GATC	1 cut(s)	338
NlaIII	CATG	5 cut(s)	41, 246, 334, 365, 558
NlaIV	GGNNCC	2 cut(s)	239, 340
NmuCI	GTSAC	1 cut(s)	390
NspI	RCATGY	1 cut(s)	334
PaqCI	CACCTGC	2 cut(s)	164, 171
PflMI	CCANNNNNTGG	1 cut(s)	21
PfoI	TCCNGGA	1 cut(s)	113
PkrI	GCNGC	2 cut(s)	101, 690
PshAI	GACNNNNGTC	1 cut(s)	109
PsiI	TTATAA	1 cut(s)	448
Psp6I	CCWGG	4 cut(s)	113, 290, 346, 569
PspGI	CCWGG	4 cut(s)	113, 290, 346, 569
PspN4I	GGNNCC	2 cut(s)	239, 340
PspPI	GGNCC	1 cut(s)	12
PstI	CTGCAG	1 cut(s)	111
PsuI	RGATCY	1 cut(s)	338
RsaI	GTAC	2 cut(s)	124, 249
RsaNI	GTAC	2 cut(s)	123, 248
RseI	CAYNNNNRTG	1 cut(s)	473
SaqAI	TTAA	3 cut(s)	412, 535, 709
SatI	GCNGC	2 cut(s)	100, 689
Sau3AI	GATC	1 cut(s)	338
Sau96I	GGNCC	1 cut(s)	12
ScaI	AGTACT	1 cut(s)	249
ScrFI	CCNGG	4 cut(s)	115, 292, 348, 571
SduI	GDGCHC	1 cut(s)	242
SfaNI	GCATC	1 cut(s)	518
SfcI	CTRYAG	1 cut(s)	107
SinI	GGWCC	1 cut(s)	12
SmiMI	CAYNNNNRTG	1 cut(s)	473
SmlI	CTYRAG	1 cut(s)	534
SmoI	CTYRAG	1 cut(s)	534
Sse9I	AATT	3 cut(s)	89, 313, 563
SspMI	CTAG	1 cut(s)	718
StyD4I	CCNGG	4 cut(s)	113, 290, 346, 569
TaaI	ACNGT	3 cut(s)	516, 548, 700
TaiI	ACGT	2 cut(s)	74, 124
TaqI	TCGA	2 cut(s)	281, 465
TasI	AATT	3 cut(s)	89, 313, 563
TatI	WGTACW	1 cut(s)	247
Tru1I	TTAA	3 cut(s)	412, 535, 709
Tru9I	TTAA	3 cut(s)	412, 535, 709
TscAI	CASTG	1 cut(s)	551
TseFI	GTSAC	1 cut(s)	390
TseI	GCWGC	2 cut(s)	99, 688
Tsp45I	GTSAC	1 cut(s)	390
TspDTI	ATGAA	5 cut(s)	18, 308, 350, 493, 592
TspRI	CASTG	1 cut(s)	551
Van91I	CCANNNNNTGG	1 cut(s)	21
Vha464I	CTTAAG	1 cut(s)	534
VpaK11BI	GGWCC	1 cut(s)	12
XapI	RAATTY	1 cut(s)	89
XbaI	TCTAGA	1 cut(s)	717
XceI	RCATGY	1 cut(s)	334
XcmI	CCANNNNNNNNNTGG	1 cut(s)	22
XmiI	GTMKAC	1 cut(s)	518
XspI	CTAG	1 cut(s)	718
ZrmI	AGTACT	1 cut(s)	249

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.