RchiOBHm_Chr7g0214661

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
32080968 .. 32083775
2808 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ19205

Sequence Viewer

Length: 150 bp
ATGTGTCTATTGTTTATATACATGCTTCATTTTATGCTGTGTGATTGTGGAATCCTTGAAGCCCTGAAGGTGCTTAGCTTGCAAGGATTTGCCTCAATTTTGGAGCCTAACCTCTGTAGAATCATGAGTCAAATTTTGACTATTTACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.63

Weight (kDa)

5.43

Isoelectric Point (pI)

54.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 132
AcuI CTGAAG 1 cut(s) 86
AgsI TTSAA 1 cut(s) 59
AluBI AGCT 1 cut(s) 78
AluI AGCT 1 cut(s) 78
ApoI RAATTY 1 cut(s) 132
BfmI CTRYAG 1 cut(s) 115
BlpI GCTNAGC 1 cut(s) 74
BmiI GGNNCC 1 cut(s) 105
Bpu1102I GCTNAGC 1 cut(s) 74
Bsp1720I GCTNAGC 1 cut(s) 74
BspHI TCATGA 1 cut(s) 123
BspLI GGNNCC 1 cut(s) 105
BstC8I GCNNGC 1 cut(s) 80
BstDEI CTNAG 1 cut(s) 74
BstMWI GCNNNNNNNGC 1 cut(s) 79
BstNSI RCATGY 1 cut(s) 25
BstSFI CTRYAG 1 cut(s) 115
Cac8I GCNNGC 1 cut(s) 80
CciI TCATGA 1 cut(s) 123
CviAII CATG 2 cut(s) 22, 124
CviJI RGCY 3 cut(s) 62, 78, 106
CviKI_1 RGCY 3 cut(s) 62, 78, 106
DdeI CTNAG 1 cut(s) 74
Eco57I CTGAAG 1 cut(s) 86
FaeI CATG 2 cut(s) 25, 127
FaiI YATR 5 cut(s) 17, 19, 23, 35, 125
FatI CATG 2 cut(s) 21, 123
Hin1II CATG 2 cut(s) 25, 127
HinfI GANTC 3 cut(s) 51, 120, 127
Hpy188III TCNNGA 1 cut(s) 124
HpyAV CCTTC 1 cut(s) 61
HpyCH4V TGCA 1 cut(s) 82
HpyF10VI GCNNNNNNNGC 1 cut(s) 79
HpyF3I CTNAG 1 cut(s) 74
Hsp92II CATG 2 cut(s) 25, 127
LmnI GCTCC 1 cut(s) 103
LpnPI CCDG 1 cut(s) 77
MluCI AATT 2 cut(s) 96, 132
MlyI GAGTC 1 cut(s) 136
MnlI CCTC 2 cut(s) 103, 122
MwoI GCNNNNNNNGC 1 cut(s) 79
NlaIII CATG 2 cut(s) 25, 127
NlaIV GGNNCC 1 cut(s) 105
NspI RCATGY 1 cut(s) 25
PagI TCATGA 1 cut(s) 123
PfeI GAWTC 2 cut(s) 51, 120
PleI GAGTC 1 cut(s) 135
PpsI GAGTC 1 cut(s) 135
PspN4I GGNNCC 1 cut(s) 105
SchI GAGTC 1 cut(s) 136
SetI ASST 3 cut(s) 72, 80, 114
SfcI CTRYAG 1 cut(s) 115
SgeI CNNG 6 cut(s) 34, 68, 76, 91, 95, 136
Sse9I AATT 2 cut(s) 96, 132
TasI AATT 2 cut(s) 96, 132
TfiI GAWTC 2 cut(s) 51, 120
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 132
XceI RCATGY 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.