Rroxscaffold_3G00240540

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
32334480 .. 32338017
3538 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00240540.1

Sequence Viewer

Length: 219 bp
ATGCGGGTCTGTTTCTTTTCCTGCGGGTTGCTTGTAGGTTTGACTAAATCAAAAAAGGTGTGCGGCAAGGTGGGTACGGCGGCTTGTAAATTAAACAAAAGAGATGTGGAGATGTGCGGCAAGGTGGGGTACGACGGCTTGTTTGACACAAGATCAGTTACTACATTTGCTGAACAAAAGTTCTCCAGAGATGGTATTCAAGTAAAAACAGGTCCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

7.81

Weight (kDa)

9.47

Isoelectric Point (pI)

25.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 5 cut(s) 4, 24, 63, 80, 117
AfaI GTAC 2 cut(s) 76, 131
AgsI TTSAA 1 cut(s) 200
ArsI GACNNNNNNTTYG 2 cut(s) 125, 157
AspS9I GGNCC 1 cut(s) 212
AvaII GGWCC 1 cut(s) 212
BccI CCATC 1 cut(s) 185
BceAI ACGGC 2 cut(s) 93, 151
BfaI CTAG 1 cut(s) 217
BisI GCNGC 3 cut(s) 64, 81, 118
BlsI GCNGC 3 cut(s) 65, 82, 119
Bme18I GGWCC 1 cut(s) 212
BmgT120I GGNCC 1 cut(s) 212
BmiI GGNNCC 1 cut(s) 214
BpmI CTGGAG 1 cut(s) 169
BslFI GGGAC 1 cut(s) 198
BsmFI GGGAC 1 cut(s) 198
Bsp143I GATC 1 cut(s) 152
BspACI CCGC 5 cut(s) 4, 24, 63, 80, 117
BspLI GGNNCC 1 cut(s) 214
BssMI GATC 1 cut(s) 152
BstKTI GATC 1 cut(s) 155
BstMBI GATC 1 cut(s) 152
Cfr13I GGNCC 1 cut(s) 212
Csp6I GTAC 2 cut(s) 75, 130
CviJI RGCY 2 cut(s) 83, 138
CviKI_1 RGCY 2 cut(s) 83, 138
CviQI GTAC 2 cut(s) 75, 130
DpnI GATC 1 cut(s) 154
DpnII GATC 1 cut(s) 152
Eco47I GGWCC 1 cut(s) 212
EcoO109I RGGNCCY 1 cut(s) 212
FaqI GGGAC 1 cut(s) 198
FauI CCCGC 1 cut(s) 17
Fnu4HI GCNGC 3 cut(s) 64, 81, 118
Fsp4HI GCNGC 3 cut(s) 64, 81, 118
FspBI CTAG 1 cut(s) 217
GluI GCNGC 3 cut(s) 64, 81, 118
GsuI CTGGAG 1 cut(s) 169
Hpy188III TCNNGA 1 cut(s) 186
Hpy99I CGWCG 1 cut(s) 137
Kzo9I GATC 1 cut(s) 152
LpnPI CCDG 3 cut(s) 34, 195, 199
MaeI CTAG 1 cut(s) 217
MaeIII GTNAC 1 cut(s) 157
MalI GATC 1 cut(s) 154
MboI GATC 1 cut(s) 152
MluCI AATT 1 cut(s) 89
MseI TTAA 1 cut(s) 92
NdeII GATC 1 cut(s) 152
NlaIV GGNNCC 1 cut(s) 214
PkrI GCNGC 3 cut(s) 65, 82, 119
PpuMI RGGWCCY 1 cut(s) 212
Psp5II RGGWCCY 1 cut(s) 212
PspN4I GGNNCC 1 cut(s) 214
PspPI GGNCC 1 cut(s) 212
PspPPI RGGWCCY 1 cut(s) 212
RsaI GTAC 2 cut(s) 76, 131
RsaNI GTAC 2 cut(s) 75, 130
SaqAI TTAA 1 cut(s) 92
SatI GCNGC 3 cut(s) 64, 81, 118
Sau3AI GATC 1 cut(s) 152
Sau96I GGNCC 1 cut(s) 212
SetI ASST 5 cut(s) 40, 60, 72, 126, 214
SinI GGWCC 1 cut(s) 212
Sse9I AATT 1 cut(s) 89
SsiI CCGC 5 cut(s) 4, 24, 63, 80, 117
SspMI CTAG 1 cut(s) 217
TasI AATT 1 cut(s) 89
TauI GCSGC 3 cut(s) 66, 83, 120
Tru1I TTAA 1 cut(s) 92
Tru9I TTAA 1 cut(s) 92
VpaK11BI GGWCC 1 cut(s) 212
XspI CTAG 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.