RchiOBHm_Chr7g0239631

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
65345632 .. 65347187
1556 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21477

Sequence Viewer

Length: 195 bp
ATGCCTAGAAACCCTAATCCCAAAACTCGCCCTATTCGCTGTAGCAAATTGAGAACTCGTTTCAAAGCCGAAGGATATAAATGGGTAAGTTTCTGTCCAAAAATAGATTGGGAAGCATTTTTACGATATCGGCCTATGTCAACCACTTTCATCCACTTCCACCTGTGGTCTCCATGGAACTGCTTGATGACATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.88

Weight (kDa)

10.38

Isoelectric Point (pI)

42.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 64
Alw26I GTCTC 1 cut(s) 174
AoxI GGCC 1 cut(s) 131
BarI GAAGNNNNNNTAC 2 cut(s) 105, 137
BcoDI GTCTC 1 cut(s) 174
BfaI CTAG 1 cut(s) 6
BfmI CTRYAG 1 cut(s) 40
BsaI GGTCTC 1 cut(s) 174
BsaJI CCNNGG 1 cut(s) 173
BseDI CCNNGG 1 cut(s) 173
BseGI GGATG 1 cut(s) 150
BshFI GGCC 1 cut(s) 133
BsmAI GTCTC 1 cut(s) 174
BsnI GGCC 1 cut(s) 133
Bso31I GGTCTC 1 cut(s) 174
Bsp19I CCATGG 1 cut(s) 173
BspANI GGCC 1 cut(s) 133
BspTNI GGTCTC 1 cut(s) 174
BssECI CCNNGG 1 cut(s) 173
BssT1I CCWWGG 1 cut(s) 173
BstDSI CCRYGG 1 cut(s) 173
BstF5I GGATG 1 cut(s) 150
BstMAI GTCTC 1 cut(s) 174
BstMWI GCNNNNNNNGC 1 cut(s) 36
BstSFI CTRYAG 1 cut(s) 40
BsuRI GGCC 1 cut(s) 133
BtgI CCRYGG 1 cut(s) 173
BtsCI GGATG 1 cut(s) 150
CviAII CATG 1 cut(s) 174
CviJI RGCY 2 cut(s) 68, 133
CviKI_1 RGCY 2 cut(s) 68, 133
Eco130I CCWWGG 1 cut(s) 173
Eco31I GGTCTC 1 cut(s) 174
Eco32I GATATC 1 cut(s) 128
EcoRV GATATC 1 cut(s) 128
EcoT14I CCWWGG 1 cut(s) 173
ErhI CCWWGG 1 cut(s) 173
FaeI CATG 1 cut(s) 177
FaiI YATR 4 cut(s) 78, 137, 175, 193
FatI CATG 1 cut(s) 173
FokI GGATG 1 cut(s) 137
FspBI CTAG 1 cut(s) 6
HaeIII GGCC 1 cut(s) 133
Hin1II CATG 1 cut(s) 177
HincII GTYRAC 1 cut(s) 141
HindII GTYRAC 1 cut(s) 141
Hpy166II GTNNAC 1 cut(s) 141
Hpy8I GTNNAC 1 cut(s) 141
HpyAV CCTTC 1 cut(s) 65
HpyF10VI GCNNNNNNNGC 1 cut(s) 36
Hsp92II CATG 1 cut(s) 177
LpnPI CCDG 1 cut(s) 176
MaeI CTAG 1 cut(s) 6
MluCI AATT 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 36
NcoI CCATGG 1 cut(s) 173
NlaIII CATG 1 cut(s) 177
SetI ASST 1 cut(s) 165
SfcI CTRYAG 1 cut(s) 40
SgeI CNNG 5 cut(s) 18, 39, 69, 175, 186
Sse9I AATT 1 cut(s) 47
SspMI CTAG 1 cut(s) 6
StyI CCWWGG 1 cut(s) 173
TasI AATT 1 cut(s) 47
TspDTI ATGAA 1 cut(s) 139
XcmI CCANNNNNNNNNTGG 1 cut(s) 105
XspI CTAG 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.