RLG00000000609

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
Physical Location & Seq
Reverse (-)
2532902 .. 2533893
992 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000000609

Sequence Viewer

Length: 534 bp
ATGATCAACCTATTGGAGTGTCAATGTCTCAATATTCTTAATCAAATTGAAGGTTATGGTACATTGAATTATAATTGGGATGAGATTTCTGATGACCTACTCTCTCAACTCCCAGATGAGTTGTTTAACCAAGTTCCTAGTCATGATCAACCTATTGGAGTGTCAATGTCTCAATATTATTGGGAAGTGGAGCATGGATTAAATGAAGAAGATATGGGTTTGACTGAAGAAGAGAATTATGTAGAAGAGGAGAGCTTTCATGATCAACCTATTGGAGTGTCAACGTCTCAATATTCTTGGGAAGTGGAGCATGGATTAAATGAAGAAGATAAGGGTTTGACTGAAGAAGAGAATTATGTAGAAGAGGAGAGCTTGTATGATAATCTTGTGCCAAATGAAGGGGAAGATGATCAATTGCAACAGAAGCCTCAATATGAACATGGAAGTGAAAATGATGACTTAGATTACGAGTTGTATGATGAAGAAAATAATGGCAAAATAGTTTTTACTATTGGCATAACAATTGATGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

178

Amino Acids

20.57

Weight (kDa)

4.05

Isoelectric Point (pI)

54.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 72
AcuI CTGAAG 2 cut(s) 246, 363
AfaI GTAC 1 cut(s) 61
AfiI CCNNNNNNNGG 1 cut(s) 398
AgsI TTSAA 2 cut(s) 50, 67
AluBI AGCT 2 cut(s) 255, 372
AluI AGCT 2 cut(s) 255, 372
Alw26I GTCTC 3 cut(s) 32, 174, 291
BclI TGATCA 4 cut(s) 3, 145, 262, 409
BcoDI GTCTC 3 cut(s) 32, 174, 291
BfaI CTAG 1 cut(s) 138
BsaXI ACNNNNNCTCC 2 cut(s) 359, 389
Bsc4I CCNNNNNNNGG 1 cut(s) 398
BseGI GGATG 1 cut(s) 85
BseLI CCNNNNNNNGG 1 cut(s) 398
BseRI GAGGAG 2 cut(s) 263, 380
BslI CCNNNNNNNGG 1 cut(s) 398
BsmAI GTCTC 3 cut(s) 32, 174, 291
BsmBI CGTCTC 1 cut(s) 291
Bsp143I GATC 4 cut(s) 3, 145, 262, 409
BspHI TCATGA 2 cut(s) 142, 259
BssMI GATC 4 cut(s) 3, 145, 262, 409
Bst6I CTCTTC 4 cut(s) 225, 240, 342, 357
BstDEI CTNAG 1 cut(s) 460
BstF5I GGATG 1 cut(s) 85
BstKTI GATC 4 cut(s) 6, 148, 265, 412
BstMAI GTCTC 3 cut(s) 32, 174, 291
BstMBI GATC 4 cut(s) 3, 145, 262, 409
BstMWI GCNNNNNNNGC 1 cut(s) 424
BtsCI GGATG 1 cut(s) 85
CciI TCATGA 2 cut(s) 142, 259
Csp6I GTAC 1 cut(s) 60
CviAII CATG 5 cut(s) 143, 194, 260, 311, 440
CviJI RGCY 3 cut(s) 255, 372, 427
CviKI_1 RGCY 3 cut(s) 255, 372, 427
CviQI GTAC 1 cut(s) 60
DdeI CTNAG 1 cut(s) 460
DpnI GATC 4 cut(s) 5, 147, 264, 411
DpnII GATC 4 cut(s) 3, 145, 262, 409
Eam1104I CTCTTC 4 cut(s) 225, 240, 342, 357
EarI CTCTTC 4 cut(s) 225, 240, 342, 357
Eco57I CTGAAG 2 cut(s) 246, 363
Esp3I CGTCTC 1 cut(s) 291
FaeI CATG 5 cut(s) 146, 197, 263, 314, 443
FatI CATG 5 cut(s) 142, 193, 259, 310, 439
FbaI TGATCA 4 cut(s) 3, 145, 262, 409
FokI GGATG 1 cut(s) 92
FspBI CTAG 1 cut(s) 138
Hin1II CATG 5 cut(s) 146, 197, 263, 314, 443
HincII GTYRAC 1 cut(s) 282
HindII GTYRAC 1 cut(s) 282
Hpy166II GTNNAC 1 cut(s) 282
Hpy188I TCNGA 1 cut(s) 91
Hpy188III TCNNGA 2 cut(s) 143, 260
Hpy8I GTNNAC 1 cut(s) 282
HpyAV CCTTC 2 cut(s) 44, 392
HpyCH4IV ACGT 1 cut(s) 284
HpyCH4V TGCA 1 cut(s) 418
HpyF10VI GCNNNNNNNGC 1 cut(s) 424
HpyF3I CTNAG 1 cut(s) 460
HpySE526I ACGT 1 cut(s) 284
Hsp92II CATG 5 cut(s) 146, 197, 263, 314, 443
Ksp22I TGATCA 4 cut(s) 3, 145, 262, 409
Kzo9I GATC 4 cut(s) 3, 145, 262, 409
LmnI GCTCC 2 cut(s) 190, 307
LpnPI CCDG 1 cut(s) 126
MaeI CTAG 1 cut(s) 138
MaeII ACGT 1 cut(s) 284
MalI GATC 4 cut(s) 5, 147, 264, 411
MboI GATC 4 cut(s) 3, 145, 262, 409
MfeI CAATTG 2 cut(s) 413, 522
MluCI AATT 7 cut(s) 45, 67, 73, 235, 352, 413, 522
MnlI CCTC 3 cut(s) 241, 358, 438
MseI TTAA 4 cut(s) 39, 126, 200, 317
MslI CAYNNNNRTG 1 cut(s) 444
MunI CAATTG 2 cut(s) 413, 522
MwoI GCNNNNNNNGC 1 cut(s) 424
NdeII GATC 4 cut(s) 3, 145, 262, 409
NlaIII CATG 5 cut(s) 146, 197, 263, 314, 443
PagI TCATGA 2 cut(s) 142, 259
PsiI TTATAA 1 cut(s) 72
RsaI GTAC 1 cut(s) 61
RsaNI GTAC 1 cut(s) 60
RseI CAYNNNNRTG 1 cut(s) 444
SaqAI TTAA 4 cut(s) 39, 126, 200, 317
Sau3AI GATC 4 cut(s) 3, 145, 262, 409
SetI ASST 8 cut(s) 12, 55, 99, 154, 257, 271, 287, 374
SmiMI CAYNNNNRTG 1 cut(s) 444
Sse9I AATT 7 cut(s) 45, 67, 73, 235, 352, 413, 522
SspI AATATT 3 cut(s) 34, 176, 293
SspMI CTAG 1 cut(s) 138
TaiI ACGT 1 cut(s) 287
TasI AATT 7 cut(s) 45, 67, 73, 235, 352, 413, 522
Tru1I TTAA 4 cut(s) 39, 126, 200, 317
Tru9I TTAA 4 cut(s) 39, 126, 200, 317
TspDTI ATGAA 6 cut(s) 219, 248, 336, 411, 450, 495
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.