RLG00000030721

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
OG0004520
Physical Location & Seq
Reverse (-)
66468637 .. 66472347
3711 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000030721

Sequence Viewer

Length: 942 bp
ATGACTCATAGAGGAGATAAATTCGATAGACGGCCTCATGACCCAGGTAATGATACACTGATTTATAATTGGGATGAGATTCCTGATGATCTGCTCTCACAAATCCCAGATGAGTTGTTCAGCCAAGTTCCCAGTCTTGATCAACATACTAGAATGTCAAAGTCTCAATTTTCTTGCGAAGTGGAACATGGATTGAATGAAGAAGAGAATTGTGTAATTGAAGAAGAGGAAGGCATGTATGATAATTTTGTGCAAAATGAAGGGGAAGATGATCAATTGCAACAGAACCCTCGATTTGAACATGGAAGTGAGAGTGATGACTCCGATTATGAATTGTATGATGAAGAAAATGATGTTGCTATAGAGGATGATCATTTATTTGATGATACTGCTGTCCATGTGTTGACTCCGTTAGGGAGACCTAATGTTGAAGATGATGATACTTTGTCACTAAACCTTTCACAAGAGAACACTGTGTTAGAGGATGAATATACTATGGAATCTGGTTCCCTGTTACCATTAAATTTCATGCAAGATAACATTGTACAAGAGAGAGAATACGATTCAGATGATTTGAACAGTCCAACAAGGAAGACTACAAGTGCTAGCCCTACTTCATGGCCAAATATACAGCCAACTGAAAATTCAAATATGCCTAGTGCAAGCACAAATTCATGGCAAGGGCTGTATTGTAATCCACATGAGACGAGCTATGTTCAAGTTCCACATCAACCTACCATTACAAGAGCGTCAAGAGGTGGCACATTCACCAGAATTCCAAGGCACAATAACTCTTCCAAGACGACTAATACCTCAACTTCTAGAGTAAACATGCCTCAACAGAAGGTTGGAACTTCAGCACCTAAGTTTGGCACATCCACAACTACGACGCAAAAGAAATCTTCCAAGAATAGTACTAGACAAGGTTCTGCACCCATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBD_Tnp_Mut MULE SWIM

Protein Analysis

314

Amino Acids

35.38

Weight (kDa)

4.39

Isoelectric Point (pI)

49.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 66
AcoI YGGCCR 1 cut(s) 620
AcsI RAATTY 5 cut(s) 20, 523, 643, 670, 774
AcuI CTGAAG 1 cut(s) 840
AfaI GTAC 2 cut(s) 546, 916
AfiI CCNNNNNNNGG 1 cut(s) 869
AgsI TTSAA 7 cut(s) 196, 221, 299, 431, 577, 648, 719
AjnI CCWGG 1 cut(s) 43
AjuI GAANNNNNNNTTGG 2 cut(s) 628, 660
AluBI AGCT 1 cut(s) 711
AluI AGCT 1 cut(s) 711
Alw26I GTCTC 3 cut(s) 168, 412, 698
AoxI GGCC 2 cut(s) 32, 620
ApoI RAATTY 5 cut(s) 20, 523, 643, 670, 774
AsuHPI GGTGA 1 cut(s) 760
AsuNHI GCTAGC 1 cut(s) 605
BaeI ACNNNNGTAYC 2 cut(s) 378, 411
BalI TGGCCA 1 cut(s) 622
BbsI GAAGAC 1 cut(s) 599
BceAI ACGGC 1 cut(s) 47
BciT130I CCWGG 1 cut(s) 45
BclI TGATCA 3 cut(s) 139, 271, 370
BcoDI GTCTC 3 cut(s) 168, 412, 698
BfaI CTAG 5 cut(s) 150, 606, 657, 822, 918
BfmI CTRYAG 1 cut(s) 360
BmcAI AGTACT 1 cut(s) 916
Bme1390I CCNGG 1 cut(s) 45
BmiI GGNNCC 1 cut(s) 508
BmrFI CCNGG 1 cut(s) 45
BmrI ACTGGG 1 cut(s) 126
BmtI GCTAGC 1 cut(s) 609
BmuI ACTGGG 1 cut(s) 126
BpiI GAAGAC 1 cut(s) 599
BsaI GGTCTC 1 cut(s) 412
BsaJI CCNNGG 2 cut(s) 43, 779
Bsc4I CCNNNNNNNGG 1 cut(s) 869
Bse1I ACTGG 1 cut(s) 132
BseBI CCWGG 1 cut(s) 45
BseDI CCNNGG 2 cut(s) 43, 779
BseGI GGATG 4 cut(s) 79, 373, 490, 875
BseLI CCNNNNNNNGG 1 cut(s) 869
BseNI ACTGG 1 cut(s) 132
BseRI GAGGAG 1 cut(s) 27
BsgI GTGCAG 1 cut(s) 915
BshFI GGCC 2 cut(s) 34, 622
BslI CCNNNNNNNGG 1 cut(s) 869
BsmAI GTCTC 3 cut(s) 168, 412, 698
BsmBI CGTCTC 1 cut(s) 698
BsnI GGCC 2 cut(s) 34, 622
Bso31I GGTCTC 1 cut(s) 412
Bsp1407I TGTACA 1 cut(s) 544
Bsp143I GATC 4 cut(s) 88, 139, 271, 370
BspANI GGCC 2 cut(s) 34, 622
BspHI TCATGA 1 cut(s) 37
BspLI GGNNCC 1 cut(s) 508
BspOI GCTAGC 1 cut(s) 609
BspTNI GGTCTC 1 cut(s) 412
BsrGI TGTACA 1 cut(s) 544
BsrI ACTGG 1 cut(s) 132
BssECI CCNNGG 2 cut(s) 43, 779
BssMI GATC 4 cut(s) 88, 139, 271, 370
BssT1I CCWWGG 1 cut(s) 779
Bst2UI CCWGG 1 cut(s) 45
Bst4CI ACNGT 2 cut(s) 475, 581
Bst6I CTCTTC 3 cut(s) 198, 219, 799
BstAUI TGTACA 1 cut(s) 544
BstC8I GCNNGC 2 cut(s) 607, 664
BstDEI CTNAG 1 cut(s) 864
BstF5I GGATG 4 cut(s) 79, 373, 490, 875
BstKTI GATC 4 cut(s) 91, 142, 274, 373
BstMAI GTCTC 3 cut(s) 168, 412, 698
BstMBI GATC 4 cut(s) 88, 139, 271, 370
BstNI CCWGG 1 cut(s) 45
BstNSI RCATGY 2 cut(s) 238, 835
BstSCI CCNGG 1 cut(s) 43
BstSFI CTRYAG 1 cut(s) 360
BstV2I GAAGAC 1 cut(s) 599
BsuRI GGCC 2 cut(s) 34, 622
BtsCI GGATG 4 cut(s) 79, 373, 490, 875
BtsIMutI CAGTG 2 cut(s) 56, 471
Cac8I GCNNGC 2 cut(s) 607, 664
CciI TCATGA 1 cut(s) 37
CseI GACGC 2 cut(s) 738, 898
Csp6I GTAC 2 cut(s) 545, 915
CviJI RGCY 7 cut(s) 34, 123, 609, 622, 634, 685, 711
CviKI_1 RGCY 7 cut(s) 34, 123, 609, 622, 634, 685, 711
CviQI GTAC 2 cut(s) 545, 915
DdeI CTNAG 1 cut(s) 864
DpnI GATC 4 cut(s) 90, 141, 273, 372
DpnII GATC 4 cut(s) 88, 139, 271, 370
EaeI YGGCCR 1 cut(s) 620
Eam1104I CTCTTC 3 cut(s) 198, 219, 799
EarI CTCTTC 3 cut(s) 198, 219, 799
Eco130I CCWWGG 1 cut(s) 779
Eco31I GGTCTC 1 cut(s) 412
Eco57I CTGAAG 1 cut(s) 840
EcoRI GAATTC 1 cut(s) 774
EcoRII CCWGG 1 cut(s) 43
EcoT14I CCWWGG 1 cut(s) 779
ErhI CCWWGG 1 cut(s) 779
Esp3I CGTCTC 1 cut(s) 698
FbaI TGATCA 3 cut(s) 139, 271, 370
FokI GGATG 4 cut(s) 86, 380, 497, 862
FspBI CTAG 5 cut(s) 150, 606, 657, 822, 918
HaeIII GGCC 2 cut(s) 34, 622
HgaI GACGC 2 cut(s) 738, 898
HincII GTYRAC 1 cut(s) 405
HindII GTYRAC 1 cut(s) 405
HinfI GANTC 6 cut(s) 4, 79, 320, 406, 500, 563
HphI GGTGA 1 cut(s) 760
Hpy166II GTNNAC 2 cut(s) 405, 829
Hpy188I TCNGA 2 cut(s) 325, 568
Hpy188III TCNNGA 5 cut(s) 38, 83, 137, 753, 822
Hpy8I GTNNAC 2 cut(s) 405, 829
Hpy99I CGWCG 1 cut(s) 892
HpyAV CCTTC 3 cut(s) 224, 254, 838
HpyCH4III ACNGT 2 cut(s) 475, 581
HpyCH4V TGCA 5 cut(s) 253, 280, 532, 662, 932
HpyF3I CTNAG 1 cut(s) 864
Ksp22I TGATCA 3 cut(s) 139, 271, 370
Kzo9I GATC 4 cut(s) 88, 139, 271, 370
LpnPI CCDG 8 cut(s) 30, 57, 96, 120, 145, 489, 524, 784
MaeI CTAG 5 cut(s) 150, 606, 657, 822, 918
MaeIII GTNAC 2 cut(s) 447, 513
MalI GATC 4 cut(s) 90, 141, 273, 372
MboI GATC 4 cut(s) 88, 139, 271, 370
MfeI CAATTG 1 cut(s) 275
MlsI TGGCCA 1 cut(s) 622
MluNI TGGCCA 1 cut(s) 622
MlyI GAGTC 2 cut(s) 314, 400
MmeI TCCRAC 2 cut(s) 608, 829
MnlI CCTC 9 cut(s) 5, 45, 220, 300, 358, 475, 749, 823, 846
Mox20I TGGCCA 1 cut(s) 622
MscI TGGCCA 1 cut(s) 622
MseI TTAA 1 cut(s) 521
MslI CAYNNNNRTG 1 cut(s) 306
Msp20I TGGCCA 1 cut(s) 622
MspR9I CCNGG 1 cut(s) 45
MunI CAATTG 1 cut(s) 275
MvaI CCWGG 1 cut(s) 45
NdeII GATC 4 cut(s) 88, 139, 271, 370
NheI GCTAGC 1 cut(s) 605
NlaIV GGNNCC 1 cut(s) 508
NmuCI GTSAC 1 cut(s) 447
NspI RCATGY 2 cut(s) 238, 835
PagI TCATGA 1 cut(s) 37
PfeI GAWTC 3 cut(s) 79, 500, 563
PleI GAGTC 2 cut(s) 314, 400
PpsI GAGTC 2 cut(s) 314, 400
PsiI TTATAA 1 cut(s) 66
Psp6I CCWGG 1 cut(s) 43
PspGI CCWGG 1 cut(s) 43
PspN4I GGNNCC 1 cut(s) 508
RsaI GTAC 2 cut(s) 546, 916
RsaNI GTAC 2 cut(s) 545, 915
RseI CAYNNNNRTG 1 cut(s) 306
SaqAI TTAA 1 cut(s) 521
Sau3AI GATC 4 cut(s) 88, 139, 271, 370
ScaI AGTACT 1 cut(s) 916
SchI GAGTC 2 cut(s) 314, 400
ScrFI CCNGG 1 cut(s) 45
SfcI CTRYAG 1 cut(s) 360
SmiMI CAYNNNNRTG 1 cut(s) 306
SspMI CTAG 5 cut(s) 150, 606, 657, 822, 918
StyD4I CCNGG 1 cut(s) 43
StyI CCWWGG 1 cut(s) 779
TaaI ACNGT 2 cut(s) 475, 581
TaqI TCGA 2 cut(s) 24, 292
TatI WGTACW 2 cut(s) 544, 914
TfiI GAWTC 3 cut(s) 79, 500, 563
Tru1I TTAA 1 cut(s) 521
Tru9I TTAA 1 cut(s) 521
TscAI CASTG 2 cut(s) 63, 478
TseFI GTSAC 1 cut(s) 447
Tsp45I GTSAC 1 cut(s) 447
TspDTI ATGAA 8 cut(s) 213, 273, 345, 357, 501, 517, 606, 663
TspGWI ACGGA 1 cut(s) 399
TspRI CASTG 2 cut(s) 63, 478
XapI RAATTY 5 cut(s) 20, 523, 643, 670, 774
XbaI TCTAGA 1 cut(s) 821
XceI RCATGY 2 cut(s) 238, 835
XspI CTAG 5 cut(s) 150, 606, 657, 822, 918
ZrmI AGTACT 1 cut(s) 916
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.