Rh7BG415700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
46854691 .. 46855619
929 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG415700.1

Sequence Viewer

Length: 279 bp
ATGACTGTCTCTTCTCTGAAACTTGACAGAGGGCCTCCTAACCCAAATGAGTTGTTTAACCAAGTTCCTAGTCATGATCAACCTACTGGAGTGTCAACGTCTCAATATTCTTGGGAAGTGGAGCATGGATTAAATGAAGAAGATAGGGGTTTGACTGAAGAAGAGAATTATGTAGAAGAAGAGGAGAGCTTGTATGATAATTTTGTGCAAAATGAAGGGGAAGATGATCAGTTGCAACAGAGGCCTCAATATGAACATGGAAGTGAAAGTGATGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

10.6

Weight (kDa)

4.05

Isoelectric Point (pI)

51.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 177
AluBI AGCT 1 cut(s) 189
AluI AGCT 1 cut(s) 189
Alw26I GTCTC 2 cut(s) 13, 105
AoxI GGCC 2 cut(s) 32, 242
AspS9I GGNCC 1 cut(s) 32
BclI TGATCA 2 cut(s) 76, 226
BcoDI GTCTC 2 cut(s) 13, 105
BfaI CTAG 1 cut(s) 69
BmgT120I GGNCC 1 cut(s) 32
BpmI CTGGAG 1 cut(s) 108
BsaXI ACNNNNNCTCC 2 cut(s) 176, 206
Bse1I ACTGG 1 cut(s) 91
BseNI ACTGG 1 cut(s) 91
BseRI GAGGAG 1 cut(s) 197
BshFI GGCC 2 cut(s) 34, 244
BsmAI GTCTC 2 cut(s) 13, 105
BsmBI CGTCTC 1 cut(s) 105
BsnI GGCC 2 cut(s) 34, 244
Bsp143I GATC 2 cut(s) 76, 226
BspANI GGCC 2 cut(s) 34, 244
BspHI TCATGA 1 cut(s) 73
BsrI ACTGG 1 cut(s) 91
BssMI GATC 2 cut(s) 76, 226
Bst4CI ACNGT 1 cut(s) 7
Bst6I CTCTTC 3 cut(s) 16, 156, 174
BstKTI GATC 2 cut(s) 79, 229
BstMAI GTCTC 2 cut(s) 13, 105
BstMBI GATC 2 cut(s) 76, 226
BstMWI GCNNNNNNNGC 1 cut(s) 241
BsuRI GGCC 2 cut(s) 34, 244
CciI TCATGA 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 32
CviAII CATG 3 cut(s) 74, 125, 257
CviJI RGCY 3 cut(s) 34, 189, 244
CviKI_1 RGCY 3 cut(s) 34, 189, 244
DpnI GATC 2 cut(s) 78, 228
DpnII GATC 2 cut(s) 76, 226
Eam1104I CTCTTC 3 cut(s) 16, 156, 174
EarI CTCTTC 3 cut(s) 16, 156, 174
Eco147I AGGCCT 1 cut(s) 244
Eco57I CTGAAG 1 cut(s) 177
EcoO109I RGGNCCY 1 cut(s) 32
Esp3I CGTCTC 1 cut(s) 105
FaeI CATG 3 cut(s) 77, 128, 260
FaiI YATR 6 cut(s) 75, 126, 171, 195, 252, 258
FatI CATG 3 cut(s) 73, 124, 256
FbaI TGATCA 2 cut(s) 76, 226
FspBI CTAG 1 cut(s) 69
GsuI CTGGAG 1 cut(s) 108
HaeIII GGCC 2 cut(s) 34, 244
Hin1II CATG 3 cut(s) 77, 128, 260
HincII GTYRAC 1 cut(s) 96
HindII GTYRAC 1 cut(s) 96
Hpy166II GTNNAC 1 cut(s) 96
Hpy188I TCNGA 1 cut(s) 18
Hpy188III TCNNGA 1 cut(s) 74
Hpy8I GTNNAC 1 cut(s) 96
HpyAV CCTTC 1 cut(s) 209
HpyCH4III ACNGT 1 cut(s) 7
HpyCH4IV ACGT 1 cut(s) 98
HpyCH4V TGCA 2 cut(s) 208, 235
HpyF10VI GCNNNNNNNGC 1 cut(s) 241
HpySE526I ACGT 1 cut(s) 98
Hsp92II CATG 3 cut(s) 77, 128, 260
Ksp22I TGATCA 2 cut(s) 76, 226
Kzo9I GATC 2 cut(s) 76, 226
LmnI GCTCC 1 cut(s) 121
LpnPI CCDG 1 cut(s) 72
MaeI CTAG 1 cut(s) 69
MaeII ACGT 1 cut(s) 98
MalI GATC 2 cut(s) 78, 228
MboI GATC 2 cut(s) 76, 226
MboII GAAGA 8 cut(s) 3, 149, 152, 170, 173, 188, 191, 233
MluCI AATT 2 cut(s) 166, 199
MnlI CCTC 5 cut(s) 23, 45, 175, 234, 255
MseI TTAA 2 cut(s) 57, 131
MslI CAYNNNNRTG 1 cut(s) 261
MwoI GCNNNNNNNGC 1 cut(s) 241
NdeII GATC 2 cut(s) 76, 226
NlaIII CATG 3 cut(s) 77, 128, 260
PagI TCATGA 1 cut(s) 73
PceI AGGCCT 1 cut(s) 244
PspPI GGNCC 1 cut(s) 32
RseI CAYNNNNRTG 1 cut(s) 261
SaqAI TTAA 2 cut(s) 57, 131
Sau3AI GATC 2 cut(s) 76, 226
Sau96I GGNCC 1 cut(s) 32
SetI ASST 3 cut(s) 85, 101, 191
SgeI CNNG 9 cut(s) 35, 74, 81, 86, 99, 123, 137, 202, 269
SmiMI CAYNNNNRTG 1 cut(s) 261
Sse9I AATT 2 cut(s) 166, 199
SseBI AGGCCT 1 cut(s) 244
SspI AATATT 1 cut(s) 107
SspMI CTAG 1 cut(s) 69
StuI AGGCCT 1 cut(s) 244
TaaI ACNGT 1 cut(s) 7
TaiI ACGT 1 cut(s) 101
TasI AATT 2 cut(s) 166, 199
Tru1I TTAA 2 cut(s) 57, 131
Tru9I TTAA 2 cut(s) 57, 131
TspDTI ATGAA 3 cut(s) 150, 228, 267
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.