Rorug02G0380600

Late embryogenesis abundant protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0004520
Physical Location & Seq
Reverse (-)
48619518 .. 48622419
2902 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0380600.1

Sequence Viewer

Length: 444 bp
ATGTTATATCCAAGGTGGTTCGATGTCACTTGGGGTTTTCCTCCACACTGGCTATGGAATTGTTACGAAGAAACAAGTGATGAGAACATTGAGGTAGCCAAACTAATGAGCGTATGCTGGTTAAATGTTAGAGGACAATTTAAGATGTCAGAACTCTCATCAGGAGTTGTTTATGAAATTGCATACATAGTTAAATTAACAAAGGAAGGATTTGGGTGGGAATTCCCTGTTACACTCAAACTCAAAGTGCCAGAGGGAAGAGAGCAAAAGCGTCAATACAGTCTACTTGAGAAGCCCATTGGAGAGTGGATAGAGCTTATTGGTGGCAGTTTCCAGGCCAAGGAAGGGGAAACTAGAGAAGTGTCGTTTGATATTTATGAACACGGTGGACACTGGAAAAGTGGGCTTATCCTCAAAGGTATCATGATCAGGCCAAAACATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LEA_2

Protein Analysis

147

Amino Acids

17.24

Weight (kDa)

6.1

Isoelectric Point (pI)

44.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PP2 PF14299 1 - 145 1.6e-29 Phloem protein 2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 283
AcsI RAATTY 1 cut(s) 221
AfiI CCNNNNNNNGG 2 cut(s) 340, 345
AjnI CCWGG 1 cut(s) 333
AluBI AGCT 1 cut(s) 316
AluI AGCT 1 cut(s) 316
AoxI GGCC 2 cut(s) 336, 431
ApoI RAATTY 1 cut(s) 221
BciT130I CCWGG 1 cut(s) 335
BclI TGATCA 1 cut(s) 426
BfaI CTAG 1 cut(s) 354
Bme1390I CCNGG 1 cut(s) 335
BmrFI CCNGG 1 cut(s) 335
BpuEI CTTGAG 1 cut(s) 308
BsaJI CCNNGG 2 cut(s) 11, 339
Bsc4I CCNNNNNNNGG 2 cut(s) 340, 345
Bse1I ACTGG 2 cut(s) 53, 398
BseBI CCWGG 1 cut(s) 335
BseDI CCNNGG 2 cut(s) 11, 339
BseLI CCNNNNNNNGG 2 cut(s) 340, 345
BseNI ACTGG 2 cut(s) 53, 398
BshFI GGCC 2 cut(s) 338, 433
BslI CCNNNNNNNGG 2 cut(s) 340, 345
BsnI GGCC 2 cut(s) 338, 433
Bsp143I GATC 1 cut(s) 426
BspANI GGCC 2 cut(s) 338, 433
BspHI TCATGA 1 cut(s) 423
BsrI ACTGG 2 cut(s) 53, 398
BssECI CCNNGG 2 cut(s) 11, 339
BssMI GATC 1 cut(s) 426
BssT1I CCWWGG 2 cut(s) 11, 339
Bst2UI CCWGG 1 cut(s) 335
Bst4CI ACNGT 2 cut(s) 281, 386
Bst6I CTCTTC 1 cut(s) 253
BstKTI GATC 1 cut(s) 429
BstMBI GATC 1 cut(s) 426
BstNI CCWGG 1 cut(s) 335
BstSCI CCNGG 1 cut(s) 333
BsuRI GGCC 2 cut(s) 338, 433
BtsIMutI CAGTG 2 cut(s) 46, 391
CciI TCATGA 1 cut(s) 423
CseI GACGC 1 cut(s) 260
CviAII CATG 1 cut(s) 424
CviJI RGCY 7 cut(s) 52, 98, 295, 316, 338, 406, 433
CviKI_1 RGCY 7 cut(s) 52, 98, 295, 316, 338, 406, 433
DpnI GATC 1 cut(s) 428
DpnII GATC 1 cut(s) 426
Eam1104I CTCTTC 1 cut(s) 253
EarI CTCTTC 1 cut(s) 253
Eco130I CCWWGG 2 cut(s) 11, 339
EcoRI GAATTC 1 cut(s) 221
EcoRII CCWGG 1 cut(s) 333
EcoT14I CCWWGG 2 cut(s) 11, 339
ErhI CCWWGG 2 cut(s) 11, 339
FaeI CATG 1 cut(s) 427
FaiI YATR 8 cut(s) 7, 55, 115, 174, 184, 188, 378, 425
FatI CATG 1 cut(s) 423
FbaI TGATCA 1 cut(s) 426
FblI GTMKAC 1 cut(s) 283
FspBI CTAG 1 cut(s) 354
HaeIII GGCC 2 cut(s) 338, 433
HgaI GACGC 1 cut(s) 260
Hin1II CATG 1 cut(s) 427
Hpy166II GTNNAC 2 cut(s) 284, 389
Hpy188I TCNGA 1 cut(s) 151
Hpy188III TCNNGA 2 cut(s) 162, 424
Hpy8I GTNNAC 2 cut(s) 284, 389
HpyAV CCTTC 2 cut(s) 200, 338
HpyCH4III ACNGT 2 cut(s) 281, 386
HpyCH4V TGCA 1 cut(s) 182
Hsp92II CATG 1 cut(s) 427
Ksp22I TGATCA 1 cut(s) 426
Kzo9I GATC 1 cut(s) 426
LpnPI CCDG 9 cut(s) 34, 103, 147, 240, 264, 320, 347, 379, 415
MaeI CTAG 1 cut(s) 354
MaeIII GTNAC 3 cut(s) 25, 62, 229
MalI GATC 1 cut(s) 428
MboI GATC 1 cut(s) 426
MboII GAAGA 2 cut(s) 80, 270
MluCI AATT 5 cut(s) 58, 137, 177, 194, 221
MnlI CCTC 5 cut(s) 51, 85, 125, 247, 422
MseI TTAA 5 cut(s) 122, 141, 192, 197, 442
MspR9I CCNGG 1 cut(s) 335
MvaI CCWGG 1 cut(s) 335
NdeII GATC 1 cut(s) 426
NlaIII CATG 1 cut(s) 427
NmuCI GTSAC 1 cut(s) 25
PagI TCATGA 1 cut(s) 423
Psp6I CCWGG 1 cut(s) 333
PspGI CCWGG 1 cut(s) 333
SaqAI TTAA 5 cut(s) 122, 141, 192, 197, 442
Sau3AI GATC 1 cut(s) 426
ScrFI CCNGG 1 cut(s) 335
SetI ASST 4 cut(s) 17, 96, 318, 421
SmlI CTYRAG 1 cut(s) 287
SmoI CTYRAG 1 cut(s) 287
Sse9I AATT 5 cut(s) 58, 137, 177, 194, 221
SspMI CTAG 1 cut(s) 354
StyD4I CCNGG 1 cut(s) 333
StyI CCWWGG 2 cut(s) 11, 339
TaaI ACNGT 2 cut(s) 281, 386
TaqI TCGA 1 cut(s) 21
TasI AATT 5 cut(s) 58, 137, 177, 194, 221
Tru1I TTAA 5 cut(s) 122, 141, 192, 197, 442
Tru9I TTAA 5 cut(s) 122, 141, 192, 197, 442
TscAI CASTG 2 cut(s) 53, 398
TseFI GTSAC 1 cut(s) 25
Tsp45I GTSAC 1 cut(s) 25
TspDTI ATGAA 2 cut(s) 189, 393
TspRI CASTG 2 cut(s) 53, 398
XapI RAATTY 1 cut(s) 221
XcmI CCANNNNNNNNNTGG 1 cut(s) 51
XmiI GTMKAC 1 cut(s) 283
XspI CTAG 1 cut(s) 354
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.