Rh7AG309500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0004520
Physical Location & Seq
Reverse (-)
34796986 .. 34800035
3050 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG309500.1

Sequence Viewer

Length: 345 bp
ATGACGAAGAAGGAATGGCTAAATATCCTGAGTTTGACGTTGCCACAGATATGGAGAACCCTGTTTTTCGTGATAGGGATGTTATTTGCTACAAAAAATGATGTGAATGAAGCAATTAAGGAGTATTCAATCAAAAGGGGTTATGAGACAACTATAAAAAAGAATGACAAGACTAGGATGACTGCAAAGTGTATCCCAGGTTGTCCTTGGAAAATTCATGCATCTCCGAATGAAGAAGGTCCAAGTTCCACGTCAACCTACCATTACAAGAGTGTCACGAGGTGGCACATTCACCACAATTTCAAGACAGAAGAACTGTTCCAAGACAACTACCTCAACTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBD_Tnp_Mut MULE SWIM

Protein Analysis

114

Amino Acids

13.5

Weight (kDa)

9.27

Isoelectric Point (pI)

48.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DBD_Tnp_Mut PF03108 24 - 79 1.7e-13 MuDR family transposase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 213
AdeI CACNNNGTG 1 cut(s) 282
AgsI TTSAA 2 cut(s) 129, 304
AjiI CACGTC 1 cut(s) 252
AjnI CCWGG 1 cut(s) 196
Alw26I GTCTC 1 cut(s) 140
ApoI RAATTY 1 cut(s) 213
AspS9I GGNCC 1 cut(s) 239
AsuHPI GGTGA 1 cut(s) 284
AvaII GGWCC 1 cut(s) 239
BauI CACGAG 1 cut(s) 277
BciT130I CCWGG 1 cut(s) 198
BciVI GTATCC 1 cut(s) 203
BcoDI GTCTC 1 cut(s) 140
BfaI CTAG 2 cut(s) 174, 343
BfuI GTATCC 1 cut(s) 203
Bme1390I CCNGG 1 cut(s) 198
Bme18I GGWCC 1 cut(s) 239
BmgBI CACGTC 1 cut(s) 252
BmgT120I GGNCC 1 cut(s) 239
BmrFI CCNGG 1 cut(s) 198
BmsI GCATC 1 cut(s) 230
BsaJI CCNNGG 2 cut(s) 196, 206
BseBI CCWGG 1 cut(s) 198
BseDI CCNNGG 2 cut(s) 196, 206
BseGI GGATG 2 cut(s) 84, 183
BseMII CTCAG 1 cut(s) 20
BsmAI GTCTC 1 cut(s) 140
BspCNI CTCAG 1 cut(s) 21
BssECI CCNNGG 2 cut(s) 196, 206
BssSI CACGAG 1 cut(s) 277
BssT1I CCWWGG 1 cut(s) 206
Bst2BI CACGAG 1 cut(s) 277
Bst2UI CCWGG 1 cut(s) 198
Bst4CI ACNGT 1 cut(s) 318
BstDEI CTNAG 1 cut(s) 29
BstF5I GGATG 2 cut(s) 84, 183
BstMAI GTCTC 1 cut(s) 140
BstNI CCWGG 1 cut(s) 198
BstSCI CCNGG 1 cut(s) 196
BstXI CCANNNNNNTGG 1 cut(s) 51
BsuI GTATCC 1 cut(s) 203
BtrI CACGTC 1 cut(s) 252
BtsCI GGATG 2 cut(s) 84, 183
Cfr13I GGNCC 1 cut(s) 239
CviAII CATG 1 cut(s) 218
CviJI RGCY 1 cut(s) 19
CviKI_1 RGCY 1 cut(s) 19
DdeI CTNAG 1 cut(s) 29
DraIII CACNNNGTG 1 cut(s) 282
Eco130I CCWWGG 1 cut(s) 206
Eco47I GGWCC 1 cut(s) 239
EcoRII CCWGG 1 cut(s) 196
EcoT14I CCWWGG 1 cut(s) 206
EcoT22I ATGCAT 1 cut(s) 223
ErhI CCWWGG 1 cut(s) 206
FaeI CATG 1 cut(s) 221
FaiI YATR 4 cut(s) 52, 144, 155, 219
FatI CATG 1 cut(s) 217
FokI GGATG 2 cut(s) 91, 190
FspBI CTAG 2 cut(s) 174, 343
Hin1II CATG 1 cut(s) 221
HincII GTYRAC 1 cut(s) 255
HindII GTYRAC 1 cut(s) 255
HphI GGTGA 1 cut(s) 284
Hpy166II GTNNAC 1 cut(s) 255
Hpy188I TCNGA 1 cut(s) 228
Hpy188III TCNNGA 4 cut(s) 28, 70, 277, 304
Hpy8I GTNNAC 1 cut(s) 255
HpyAV CCTTC 2 cut(s) 4, 230
HpyCH4III ACNGT 1 cut(s) 318
HpyCH4IV ACGT 2 cut(s) 38, 251
HpyCH4V TGCA 2 cut(s) 185, 221
HpyF3I CTNAG 1 cut(s) 29
HpySE526I ACGT 2 cut(s) 38, 251
Hsp92II CATG 1 cut(s) 221
LpnPI CCDG 4 cut(s) 41, 74, 183, 210
LweI GCATC 1 cut(s) 230
MaeI CTAG 2 cut(s) 174, 343
MaeII ACGT 2 cut(s) 38, 251
MaeIII GTNAC 1 cut(s) 274
MboII GAAGA 3 cut(s) 19, 245, 323
MluCI AATT 3 cut(s) 114, 213, 298
MnlI CCTC 2 cut(s) 273, 344
Mph1103I ATGCAT 1 cut(s) 223
MseI TTAA 1 cut(s) 117
MslI CAYNNNNRTG 1 cut(s) 49
MspR9I CCNGG 1 cut(s) 198
MvaI CCWGG 1 cut(s) 198
NlaIII CATG 1 cut(s) 221
NmuCI GTSAC 1 cut(s) 274
NsiI ATGCAT 1 cut(s) 223
Psp6I CCWGG 1 cut(s) 196
PspGI CCWGG 1 cut(s) 196
PspPI GGNCC 1 cut(s) 239
RseI CAYNNNNRTG 1 cut(s) 49
SaqAI TTAA 1 cut(s) 117
Sau96I GGNCC 1 cut(s) 239
ScrFI CCNGG 1 cut(s) 198
SetI ASST 7 cut(s) 41, 202, 241, 254, 260, 284, 336
SfaNI GCATC 1 cut(s) 230
SinI GGWCC 1 cut(s) 239
SmiMI CAYNNNNRTG 1 cut(s) 49
Sse9I AATT 3 cut(s) 114, 213, 298
SspMI CTAG 2 cut(s) 174, 343
StyD4I CCNGG 1 cut(s) 196
StyI CCWWGG 1 cut(s) 206
TaaI ACNGT 1 cut(s) 318
TaiI ACGT 2 cut(s) 41, 254
TasI AATT 3 cut(s) 114, 213, 298
Tru1I TTAA 1 cut(s) 117
Tru9I TTAA 1 cut(s) 117
TseFI GTSAC 1 cut(s) 274
Tsp45I GTSAC 1 cut(s) 274
TspDTI ATGAA 3 cut(s) 123, 206, 246
VpaK11BI GGWCC 1 cut(s) 239
XapI RAATTY 1 cut(s) 213
XcmI CCANNNNNNNNNTGG 1 cut(s) 204
XspI CTAG 2 cut(s) 174, 343
Zsp2I ATGCAT 1 cut(s) 223
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.