Rh5AG414900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
71666566 .. 71667402
837 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG414900.1

Sequence Viewer

Length: 480 bp
ATGCAGGTTGTGAGTAGAAAGGGAAAGACCATTACATATACCAAGTGTTATGGAAAAGGACACAATAGGAGAAGTTGTAAAAATCAGCCTGTAGATGTCCTTCCAAATGTCTACGTTGATAAAAGATATGCTTATCCAAGGCCAGCAAGTGTTGGTGAGAAAAGAGGTGAACAAAGTGGTGAAAATTTAGAACAATGTTCTAGACAAAGCAACAAGGTTCAAGTTCCACATCAACCTACCATTACAAGAGCATCAAGAGGTGGCACATTCACTAGAATTCCAAGGCACAATAACTCTTCCAAGACGAGTAATATCTCAACTTCTAGAGTAAACATGCCTAAACAGAAGGTTGGAACTTCAGCTCCTAAGTTTGGCACATCCACAACCACAACGCAAAAGAAATCTTCCAAGAATAGTACTAGACAAGGTTCTGCACCCATATGGAGACCACCTGGAATGACTCCTCAGCAGAAAAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

159

Amino Acids

17.68

Weight (kDa)

10.95

Isoelectric Point (pI)

55.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 111
AcsI RAATTY 2 cut(s) 184, 276
AcuI CTGAAG 1 cut(s) 342
AfaI GTAC 1 cut(s) 418
AfiI CCNNNNNNNGG 1 cut(s) 371
AgsI TTSAA 1 cut(s) 221
AjnI CCWGG 1 cut(s) 451
AloI GAACNNNNNNTCC 2 cut(s) 346, 378
AluBI AGCT 1 cut(s) 362
AluI AGCT 1 cut(s) 362
Alw26I GTCTC 1 cut(s) 439
AoxI GGCC 1 cut(s) 140
ApoI RAATTY 2 cut(s) 184, 276
AsuHPI GGTGA 3 cut(s) 167, 179, 191
BarI GAAGNNNNNNTAC 2 cut(s) 84, 116
BbvCI CCTCAGC 1 cut(s) 465
BciT130I CCWGG 1 cut(s) 453
BcoDI GTCTC 1 cut(s) 439
BfaI CTAG 4 cut(s) 201, 273, 324, 420
BfmI CTRYAG 1 cut(s) 90
BmcAI AGTACT 1 cut(s) 418
Bme1390I CCNGG 1 cut(s) 453
BmrFI CCNGG 1 cut(s) 453
BmsI GCATC 1 cut(s) 260
Bpu10I CCTNAGC 1 cut(s) 465
BsaI GGTCTC 1 cut(s) 439
BsaJI CCNNGG 2 cut(s) 137, 281
BsaXI ACNNNNNCTCC 4 cut(s) 61, 91, 346, 376
Bsc4I CCNNNNNNNGG 1 cut(s) 371
BseBI CCWGG 1 cut(s) 453
BseDI CCNNGG 2 cut(s) 137, 281
BseGI GGATG 1 cut(s) 377
BseLI CCNNNNNNNGG 1 cut(s) 371
BseMII CTCAG 1 cut(s) 479
BseRI GAGGAG 1 cut(s) 453
BsgI GTGCAG 1 cut(s) 417
BshFI GGCC 1 cut(s) 142
BslI CCNNNNNNNGG 1 cut(s) 371
BsmAI GTCTC 1 cut(s) 439
BsnI GGCC 1 cut(s) 142
Bso31I GGTCTC 1 cut(s) 439
BspANI GGCC 1 cut(s) 142
BspCNI CTCAG 1 cut(s) 478
BspTNI GGTCTC 1 cut(s) 439
BssECI CCNNGG 2 cut(s) 137, 281
BssT1I CCWWGG 2 cut(s) 137, 281
Bst2UI CCWGG 1 cut(s) 453
Bst6I CTCTTC 1 cut(s) 301
BstC8I GCNNGC 1 cut(s) 144
BstDEI CTNAG 2 cut(s) 366, 465
BstF5I GGATG 1 cut(s) 377
BstMAI GTCTC 1 cut(s) 439
BstNI CCWGG 1 cut(s) 453
BstNSI RCATGY 1 cut(s) 337
BstSCI CCNGG 1 cut(s) 451
BstSFI CTRYAG 1 cut(s) 90
BsuRI GGCC 1 cut(s) 142
BtsCI GGATG 1 cut(s) 377
Cac8I GCNNGC 1 cut(s) 144
Csp6I GTAC 1 cut(s) 417
CviAII CATG 1 cut(s) 334
CviJI RGCY 3 cut(s) 88, 142, 362
CviKI_1 RGCY 3 cut(s) 88, 142, 362
CviQI GTAC 1 cut(s) 417
DdeI CTNAG 2 cut(s) 366, 465
Eam1104I CTCTTC 1 cut(s) 301
EarI CTCTTC 1 cut(s) 301
Eco130I CCWWGG 2 cut(s) 137, 281
Eco31I GGTCTC 1 cut(s) 439
Eco57I CTGAAG 1 cut(s) 342
EcoRI GAATTC 1 cut(s) 276
EcoRII CCWGG 1 cut(s) 451
EcoT14I CCWWGG 2 cut(s) 137, 281
ErhI CCWWGG 2 cut(s) 137, 281
FaeI CATG 1 cut(s) 337
FaiI YATR 7 cut(s) 37, 39, 51, 129, 335, 440, 442
FalI AAGNNNNNCTT 2 cut(s) 115, 147
FatI CATG 1 cut(s) 333
FauNDI CATATG 1 cut(s) 440
FblI GTMKAC 1 cut(s) 111
FokI GGATG 1 cut(s) 364
FspBI CTAG 4 cut(s) 201, 273, 324, 420
HaeIII GGCC 1 cut(s) 142
Hin1II CATG 1 cut(s) 337
HinfI GANTC 1 cut(s) 460
HphI GGTGA 3 cut(s) 167, 179, 191
Hpy166II GTNNAC 3 cut(s) 112, 170, 331
Hpy188III TCNNGA 3 cut(s) 201, 255, 324
Hpy8I GTNNAC 3 cut(s) 112, 170, 331
HpyAV CCTTC 2 cut(s) 110, 340
HpyCH4IV ACGT 1 cut(s) 114
HpyCH4V TGCA 2 cut(s) 4, 434
HpyF3I CTNAG 2 cut(s) 366, 465
HpySE526I ACGT 1 cut(s) 114
Hsp92II CATG 1 cut(s) 337
LmnI GCTCC 1 cut(s) 367
LpnPI CCDG 4 cut(s) 102, 156, 438, 465
LweI GCATC 1 cut(s) 260
MaeI CTAG 4 cut(s) 201, 273, 324, 420
MaeII ACGT 1 cut(s) 114
MboII GAAGA 2 cut(s) 288, 396
MluCI AATT 2 cut(s) 184, 276
MlyI GAGTC 1 cut(s) 454
MmeI TCCRAC 1 cut(s) 331
MnlI CCTC 3 cut(s) 158, 251, 474
MslI CAYNNNNRTG 1 cut(s) 439
MspR9I CCNGG 1 cut(s) 453
MvaI CCWGG 1 cut(s) 453
NdeI CATATG 1 cut(s) 440
NlaIII CATG 1 cut(s) 337
NspI RCATGY 1 cut(s) 337
PleI GAGTC 1 cut(s) 454
PpsI GAGTC 1 cut(s) 454
Psp6I CCWGG 1 cut(s) 451
PspGI CCWGG 1 cut(s) 451
RsaI GTAC 1 cut(s) 418
RsaNI GTAC 1 cut(s) 417
RseI CAYNNNNRTG 1 cut(s) 439
ScaI AGTACT 1 cut(s) 418
SchI GAGTC 1 cut(s) 454
ScrFI CCNGG 1 cut(s) 453
SfaNI GCATC 1 cut(s) 260
SfcI CTRYAG 1 cut(s) 90
SmiMI CAYNNNNRTG 1 cut(s) 439
Sse9I AATT 2 cut(s) 184, 276
SspMI CTAG 4 cut(s) 201, 273, 324, 420
StyD4I CCNGG 1 cut(s) 451
StyI CCWWGG 2 cut(s) 137, 281
TaiI ACGT 1 cut(s) 117
TasI AATT 2 cut(s) 184, 276
TatI WGTACW 1 cut(s) 416
XapI RAATTY 2 cut(s) 184, 276
XbaI TCTAGA 2 cut(s) 200, 323
XceI RCATGY 1 cut(s) 337
XmiI GTMKAC 1 cut(s) 111
XspI CTAG 4 cut(s) 201, 273, 324, 420
ZrmI AGTACT 1 cut(s) 418
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.