Rmu_sc0021420.1_g000001

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0021420.1
OG0004520
Physical Location & Seq
Reverse (-)
1 .. 470
470 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0021420.1_g000001.1.cds

Sequence Viewer

Length: 256 bp
atgaatggctacaggcctctcattggtttagatgggtgtcacataaaaaggcaccatcctggacagttattagcagcagttggcatagatgcaagcaatgggatgttcgcaattgcatatgccattgctgaagctgagaaccaagagacctggacctggttcctagagcttttgaaatcagatttgaatatggacagggatagcagctatgcctttatcacatataagcagaaggggctaggaaatgcaatagcag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBD_Tnp_Mut MULE SWIM

Protein Analysis

85

Amino Acids

9.41

Weight (kDa)

5.8

Isoelectric Point (pI)

22.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 51
AcuI CTGAAG 1 cut(s) 150
AfiI CCNNNNNNNGG 2 cut(s) 23, 156
AgsI TTSAA 2 cut(s) 175, 187
AjnI CCWGG 3 cut(s) 58, 149, 155
AluBI AGCT 3 cut(s) 134, 169, 207
AluI AGCT 3 cut(s) 134, 169, 207
Alw26I GTCTC 1 cut(s) 140
AoxI GGCC 1 cut(s) 14
ApeKI GCWGC 2 cut(s) 74, 204
AspS9I GGNCC 1 cut(s) 153
AvaII GGWCC 1 cut(s) 153
BanI GGYRCC 1 cut(s) 51
BbvI GCAGC 2 cut(s) 86, 216
BccI CCATC 2 cut(s) 26, 63
BciT130I CCWGG 3 cut(s) 60, 151, 157
BcoDI GTCTC 1 cut(s) 140
BfaI CTAG 2 cut(s) 164, 239
BfmI CTRYAG 1 cut(s) 10
BisI GCNGC 2 cut(s) 75, 205
BlsI GCNGC 2 cut(s) 76, 206
Bme1390I CCNGG 3 cut(s) 60, 151, 157
Bme18I GGWCC 1 cut(s) 153
BmgT120I GGNCC 1 cut(s) 153
BmiI GGNNCC 2 cut(s) 53, 161
BmrFI CCNGG 3 cut(s) 60, 151, 157
BmsI GCATC 1 cut(s) 79
BsaI GGTCTC 1 cut(s) 140
Bsc4I CCNNNNNNNGG 2 cut(s) 23, 156
Bse3DI GCAATG 2 cut(s) 103, 123
BseBI CCWGG 3 cut(s) 60, 151, 157
BseGI GGATG 2 cut(s) 55, 108
BseLI CCNNNNNNNGG 2 cut(s) 23, 156
BseMI GCAATG 2 cut(s) 103, 123
BseMII CTCAG 1 cut(s) 126
BseXI GCAGC 2 cut(s) 86, 216
BshFI GGCC 1 cut(s) 16
BshNI GGYRCC 1 cut(s) 51
BslI CCNNNNNNNGG 2 cut(s) 23, 156
BsmAI GTCTC 1 cut(s) 140
BsnI GGCC 1 cut(s) 16
Bso31I GGTCTC 1 cut(s) 140
BspANI GGCC 1 cut(s) 16
BspCNI CTCAG 1 cut(s) 127
BspLI GGNNCC 2 cut(s) 53, 161
BspT107I GGYRCC 1 cut(s) 51
BspTNI GGTCTC 1 cut(s) 140
BsrDI GCAATG 2 cut(s) 103, 123
Bst2UI CCWGG 3 cut(s) 60, 151, 157
Bst4CI ACNGT 1 cut(s) 66
BstC8I GCNNGC 1 cut(s) 94
BstDEI CTNAG 1 cut(s) 135
BstF5I GGATG 2 cut(s) 55, 108
BstMAI GTCTC 1 cut(s) 140
BstMWI GCNNNNNNNGC 1 cut(s) 235
BstNI CCWGG 3 cut(s) 60, 151, 157
BstSCI CCNGG 3 cut(s) 58, 149, 155
BstSFI CTRYAG 1 cut(s) 10
BstV1I GCAGC 2 cut(s) 86, 216
BsuRI GGCC 1 cut(s) 16
BtsCI GGATG 2 cut(s) 55, 108
Cac8I GCNNGC 1 cut(s) 94
Cfr13I GGNCC 1 cut(s) 153
CsiI ACCWGGT 1 cut(s) 155
CviJI RGCY 6 cut(s) 9, 16, 134, 169, 207, 238
CviKI_1 RGCY 6 cut(s) 9, 16, 134, 169, 207, 238
DdeI CTNAG 1 cut(s) 135
Eco147I AGGCCT 1 cut(s) 16
Eco31I GGTCTC 1 cut(s) 140
Eco47I GGWCC 1 cut(s) 153
Eco57I CTGAAG 1 cut(s) 150
EcoRII CCWGG 3 cut(s) 58, 149, 155
FaiI YATR 8 cut(s) 44, 86, 118, 120, 191, 210, 223, 225
FauNDI CATATG 1 cut(s) 118
Fnu4HI GCNGC 2 cut(s) 75, 205
FokI GGATG 2 cut(s) 42, 115
Fsp4HI GCNGC 2 cut(s) 75, 205
FspBI CTAG 2 cut(s) 164, 239
GluI GCNGC 2 cut(s) 75, 205
HaeIII GGCC 1 cut(s) 16
Hpy188I TCNGA 1 cut(s) 181
HpyAV CCTTC 1 cut(s) 226
HpyCH4III ACNGT 1 cut(s) 66
HpyCH4V TGCA 3 cut(s) 92, 116, 248
HpyF10VI GCNNNNNNNGC 1 cut(s) 235
HpyF3I CTNAG 1 cut(s) 135
LpnPI CCDG 7 cut(s) 45, 72, 136, 142, 163, 169, 181
Lsp1109I GCAGC 2 cut(s) 86, 216
LweI GCATC 1 cut(s) 79
MabI ACCWGGT 1 cut(s) 155
MaeI CTAG 2 cut(s) 164, 239
MaeIII GTNAC 1 cut(s) 38
MfeI CAATTG 1 cut(s) 111
MluCI AATT 1 cut(s) 111
MnlI CCTC 1 cut(s) 27
MspR9I CCNGG 3 cut(s) 60, 151, 157
MunI CAATTG 1 cut(s) 111
MvaI CCWGG 3 cut(s) 60, 151, 157
MwoI GCNNNNNNNGC 1 cut(s) 235
NdeI CATATG 1 cut(s) 118
NlaIV GGNNCC 2 cut(s) 53, 161
NmuCI GTSAC 1 cut(s) 38
PceI AGGCCT 1 cut(s) 16
PfoI TCCNGGA 1 cut(s) 58
PkrI GCNGC 2 cut(s) 76, 206
Psp6I CCWGG 3 cut(s) 58, 149, 155
PspGI CCWGG 3 cut(s) 58, 149, 155
PspN4I GGNNCC 2 cut(s) 53, 161
PspPI GGNCC 1 cut(s) 153
SatI GCNGC 2 cut(s) 75, 205
Sau96I GGNCC 1 cut(s) 153
ScrFI CCNGG 3 cut(s) 60, 151, 157
SetI ASST 5 cut(s) 136, 152, 158, 171, 209
SexAI ACCWGGT 1 cut(s) 155
SfaNI GCATC 1 cut(s) 79
SfcI CTRYAG 1 cut(s) 10
SinI GGWCC 1 cut(s) 153
Sse9I AATT 1 cut(s) 111
SseBI AGGCCT 1 cut(s) 16
SspMI CTAG 2 cut(s) 164, 239
StuI AGGCCT 1 cut(s) 16
StyD4I CCNGG 3 cut(s) 58, 149, 155
TaaI ACNGT 1 cut(s) 66
TasI AATT 1 cut(s) 111
TseFI GTSAC 1 cut(s) 38
TseI GCWGC 2 cut(s) 74, 204
Tsp45I GTSAC 1 cut(s) 38
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 153
XspI CTAG 2 cut(s) 164, 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.