Rh7BG415900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
46858232 .. 46858561
330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG415900.1

Sequence Viewer

Length: 246 bp
ATGCCTAGTGCAAGCACAAACTCATGGCAAGGGCTGTATTGCAATCCACATGAGGCTAGCTATGTCCAAGTTCCACGCCAACCTACCATTACAAGAGTGTCACGAGGTGGCACATTCACCACAATTCCAAGACACAAGAATTGTTCCAAGACAACTACCTCAACTTCTAGAGTAAACATTATGCCTCAACAGAAGGCTGGAACTTCAGCTCCTAAGTTTGACACAAAAGAAATCTTCCAAGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

81

Amino Acids

9.02

Weight (kDa)

9.92

Isoelectric Point (pI)

51.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 189
AdeI CACNNNGTG 1 cut(s) 107
AloI GAACNNNNNNTCC 2 cut(s) 193, 225
AluBI AGCT 2 cut(s) 60, 209
AluI AGCT 2 cut(s) 60, 209
AsuHPI GGTGA 1 cut(s) 109
AsuNHI GCTAGC 1 cut(s) 56
BauI CACGAG 1 cut(s) 102
BfaI CTAG 3 cut(s) 6, 57, 168
BmtI GCTAGC 1 cut(s) 60
BsaXI ACNNNNNCTCC 2 cut(s) 193, 223
BspOI GCTAGC 1 cut(s) 60
BssSI CACGAG 1 cut(s) 102
Bst2BI CACGAG 1 cut(s) 102
BstC8I GCNNGC 2 cut(s) 13, 58
BstDEI CTNAG 1 cut(s) 213
Cac8I GCNNGC 2 cut(s) 13, 58
CviAII CATG 2 cut(s) 24, 50
CviJI RGCY 5 cut(s) 34, 56, 60, 197, 209
CviKI_1 RGCY 5 cut(s) 34, 56, 60, 197, 209
DdeI CTNAG 1 cut(s) 213
DraIII CACNNNGTG 1 cut(s) 107
Eco57I CTGAAG 1 cut(s) 189
FaeI CATG 2 cut(s) 27, 53
FaiI YATR 4 cut(s) 25, 51, 63, 182
FatI CATG 2 cut(s) 23, 49
FspBI CTAG 3 cut(s) 6, 57, 168
Hin1II CATG 2 cut(s) 27, 53
HphI GGTGA 1 cut(s) 109
Hpy166II GTNNAC 1 cut(s) 175
Hpy188III TCNNGA 2 cut(s) 102, 168
Hpy8I GTNNAC 1 cut(s) 175
HpyAV CCTTC 1 cut(s) 187
HpyCH4V TGCA 2 cut(s) 11, 42
HpyF3I CTNAG 1 cut(s) 213
Hsp92II CATG 2 cut(s) 27, 53
LmnI GCTCC 1 cut(s) 214
LpnPI CCDG 1 cut(s) 183
MaeI CTAG 3 cut(s) 6, 57, 168
MaeIII GTNAC 1 cut(s) 99
MboII GAAGA 1 cut(s) 226
MluCI AATT 2 cut(s) 123, 139
MnlI CCTC 4 cut(s) 46, 98, 169, 195
NheI GCTAGC 1 cut(s) 56
NlaIII CATG 2 cut(s) 27, 53
NmuCI GTSAC 1 cut(s) 99
SetI ASST 5 cut(s) 62, 85, 109, 161, 211
Sse9I AATT 2 cut(s) 123, 139
SspMI CTAG 3 cut(s) 6, 57, 168
TasI AATT 2 cut(s) 123, 139
TseFI GTSAC 1 cut(s) 99
Tsp45I GTSAC 1 cut(s) 99
XbaI TCTAGA 1 cut(s) 167
XspI CTAG 3 cut(s) 6, 57, 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.