RLG00000009404

Cleft lip and palate transmembrane protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
OG0003699
Physical Location & Seq
Reverse (-)
52439948 .. 52442696
2749 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000009404

Sequence Viewer

Length: 399 bp
ATGGCCAATTTGTTGATTCTGCATCAGATTGATCAGTCTTTCCAAATTCGCCGTAGTTATGGAAGCATGCTCGAGGGTGAGGCTGATGAACTCAAGACGGAAGGGAAAGTCGAAAACTTTTTGTCGCAAAGGAGAATTAATGGTTATGTTAAGAGCTTTGATCAGAAAGCTAACAAGCTACGATCCGAACATTCTGCCACTGAAGAGCGAAGGAGCAGTAAAATAAATGCCAGCAACTTTGTCTTCAATCAGAATATCAGATCAATATATGAGTATAGCGCCTTCTGTGTGATATTCAGGTTCTTGGTCAAGGTAGCTGTGTTGATATCTGCCATTAGTTTTTGGTTGGAAGAAAACAGAGAGGGTGAGATATTTGGAAAGGGAGACAACAGATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CLPTM1

Protein Analysis

133

Amino Acids

15.37

Weight (kDa)

8.76

Isoelectric Point (pI)

49.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 177
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 45
AcuI CTGAAG 1 cut(s) 222
AgsI TTSAA 1 cut(s) 247
AluBI AGCT 4 cut(s) 156, 170, 178, 317
AluI AGCT 4 cut(s) 156, 170, 178, 317
Alw26I GTCTC 1 cut(s) 378
AlwI GGATC 1 cut(s) 177
Ama87I CYCGRG 1 cut(s) 71
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 1 cut(s) 45
AseI ATTAAT 1 cut(s) 138
AspLEI GCGC 1 cut(s) 281
AsuHPI GGTGA 2 cut(s) 89, 377
AvaI CYCGRG 1 cut(s) 71
BalI TGGCCA 1 cut(s) 5
BarI GAAGNNNNNNTAC 2 cut(s) 266, 298
BbsI GAAGAC 1 cut(s) 235
BceAI ACGGC 1 cut(s) 36
BcgI CGANNNNNNTGC 2 cut(s) 176, 210
BclI TGATCA 2 cut(s) 31, 160
BcoDI GTCTC 1 cut(s) 378
BfoI RGCGCY 1 cut(s) 282
BmeT110I CYCGRG 1 cut(s) 71
BmsI GCATC 1 cut(s) 31
BpiI GAAGAC 1 cut(s) 235
BpuEI CTTGAG 1 cut(s) 77
BshFI GGCC 1 cut(s) 5
BsiHKCI CYCGRG 1 cut(s) 71
BsmAI GTCTC 1 cut(s) 378
BsnI GGCC 1 cut(s) 5
BsoBI CYCGRG 1 cut(s) 71
Bsp143I GATC 4 cut(s) 31, 160, 182, 260
BspANI GGCC 1 cut(s) 5
BspPI GGATC 1 cut(s) 177
BspQI GCTCTTC 1 cut(s) 198
BssMI GATC 4 cut(s) 31, 160, 182, 260
Bst6I CTCTTC 1 cut(s) 198
BstC8I GCNNGC 2 cut(s) 68, 232
BstH2I RGCGCY 1 cut(s) 282
BstHHI GCGC 1 cut(s) 281
BstKTI GATC 4 cut(s) 34, 163, 185, 263
BstMAI GTCTC 1 cut(s) 378
BstMBI GATC 4 cut(s) 31, 160, 182, 260
BstNSI RCATGY 1 cut(s) 70
BstV2I GAAGAC 1 cut(s) 235
BsuRI GGCC 1 cut(s) 5
BtsIMutI CAGTG 1 cut(s) 198
Cac8I GCNNGC 2 cut(s) 68, 232
CfoI GCGC 1 cut(s) 281
CviAII CATG 1 cut(s) 67
CviJI RGCY 6 cut(s) 5, 83, 156, 170, 178, 317
CviKI_1 RGCY 6 cut(s) 5, 83, 156, 170, 178, 317
DpnI GATC 4 cut(s) 33, 162, 184, 262
DpnII GATC 4 cut(s) 31, 160, 182, 260
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 198
EarI CTCTTC 1 cut(s) 198
Eco32I GATATC 1 cut(s) 327
Eco57I CTGAAG 1 cut(s) 222
Eco88I CYCGRG 1 cut(s) 71
EcoRV GATATC 1 cut(s) 327
FaeI CATG 1 cut(s) 70
FaiI YATR 6 cut(s) 60, 68, 147, 268, 270, 276
FatI CATG 1 cut(s) 66
FbaI TGATCA 2 cut(s) 31, 160
GlaI GCGC 1 cut(s) 280
HaeII RGCGCY 1 cut(s) 282
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 281
Hin1II CATG 1 cut(s) 70
Hin6I GCGC 1 cut(s) 279
HinP1I GCGC 1 cut(s) 279
HinfI GANTC 1 cut(s) 16
HphI GGTGA 2 cut(s) 89, 377
Hpy188I TCNGA 5 cut(s) 27, 165, 187, 252, 260
Hpy188III TCNNGA 1 cut(s) 94
HpyAV CCTTC 3 cut(s) 95, 204, 292
HpyCH4V TGCA 1 cut(s) 22
Hsp92II CATG 1 cut(s) 70
HspAI GCGC 1 cut(s) 279
Ksp22I TGATCA 2 cut(s) 31, 160
Kzo9I GATC 4 cut(s) 31, 160, 182, 260
LguI GCTCTTC 1 cut(s) 198
LmnI GCTCC 1 cut(s) 213
LpnPI CCDG 2 cut(s) 244, 283
LweI GCATC 1 cut(s) 31
MalI GATC 4 cut(s) 33, 162, 184, 262
MboI GATC 4 cut(s) 31, 160, 182, 260
MboII GAAGA 3 cut(s) 215, 235, 362
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 3 cut(s) 7, 45, 135
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 327
MnlI CCTC 3 cut(s) 67, 73, 355
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 2 cut(s) 138, 150
Msp20I TGGCCA 1 cut(s) 5
NdeII GATC 4 cut(s) 31, 160, 182, 260
NlaIII CATG 1 cut(s) 70
NspI RCATGY 1 cut(s) 70
PaeI GCATGC 1 cut(s) 70
PaeR7I CTCGAG 1 cut(s) 71
PciSI GCTCTTC 1 cut(s) 198
PfeI GAWTC 1 cut(s) 16
PshBI ATTAAT 1 cut(s) 138
PspXI VCTCGAGB 1 cut(s) 71
SapI GCTCTTC 1 cut(s) 198
SaqAI TTAA 2 cut(s) 138, 150
Sau3AI GATC 4 cut(s) 31, 160, 182, 260
SetI ASST 6 cut(s) 158, 172, 180, 302, 315, 319
SfaNI GCATC 1 cut(s) 31
Sfr274I CTCGAG 1 cut(s) 71
SgeI CNNG 9 cut(s) 79, 83, 85, 106, 187, 243, 310, 316, 322
SlaI CTCGAG 1 cut(s) 71
SmlI CTYRAG 2 cut(s) 71, 92
SmoI CTYRAG 2 cut(s) 71, 92
SphI GCATGC 1 cut(s) 70
Sse9I AATT 3 cut(s) 7, 45, 135
TaqI TCGA 2 cut(s) 72, 111
TasI AATT 3 cut(s) 7, 45, 135
TfiI GAWTC 1 cut(s) 16
Tru1I TTAA 2 cut(s) 138, 150
Tru9I TTAA 2 cut(s) 138, 150
TscAI CASTG 1 cut(s) 205
TspDTI ATGAA 1 cut(s) 102
TspGWI ACGGA 1 cut(s) 113
TspRI CASTG 1 cut(s) 205
VspI ATTAAT 1 cut(s) 138
XapI RAATTY 1 cut(s) 45
XceI RCATGY 1 cut(s) 70
XhoI CTCGAG 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.