Rroxscaffold_3G00252750

Coiled-coil domain-containing protein 94 homolog

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Forward (+)
46810662 .. 46811916
1255 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00252750.1

Sequence Viewer

Length: 297 bp
ATGAAATCTTTGGAGAACATGTGCTTGGATTCAAAAAGGGGGATGGATACGCTTGCCACTTTGGATGAGATGAAGTCCATGAAGTTGTACATAGCACCTACATATTCATGTTGCAAGTTTCATAGCTATGTATGCTACACTTGCCAGTCGCGATGTGGACTATTGTTTGATTCCAGATTCCCCCTTTCTTTCCTAAAAGGACGAGGTGGACTTTTTGAGTTCATTGAAAAACGACTCGGAAAATGGACATATGGTTATTGTGATTGCTTGAGGAAGCAGGACATGATCTTCTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

98

Amino Acids

11.51

Weight (kDa)

8.8

Isoelectric Point (pI)

43.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 151
AfaI GTAC 1 cut(s) 89
AflIII ACRYGT 1 cut(s) 18
AgsI TTSAA 2 cut(s) 33, 227
AjuI GAANNNNNNNTTGG 2 cut(s) 8, 40
AluBI AGCT 1 cut(s) 126
AluI AGCT 1 cut(s) 126
BccI CCATC 1 cut(s) 37
BciVI GTATCC 1 cut(s) 40
BfuI GTATCC 1 cut(s) 40
BpuEI CTTGAG 1 cut(s) 289
BsaXI ACNNNNNCTCC 2 cut(s) 5, 35
Bse1I ACTGG 1 cut(s) 145
BseGI GGATG 2 cut(s) 48, 70
BseNI ACTGG 1 cut(s) 145
Bsh1236I CGCG 1 cut(s) 151
Bsp1407I TGTACA 1 cut(s) 87
Bsp143I GATC 1 cut(s) 285
Bsp68I TCGCGA 1 cut(s) 151
BspFNI CGCG 1 cut(s) 151
BsrGI TGTACA 1 cut(s) 87
BsrI ACTGG 1 cut(s) 145
BssMI GATC 1 cut(s) 285
BstAUI TGTACA 1 cut(s) 87
BstC8I GCNNGC 1 cut(s) 54
BstF5I GGATG 2 cut(s) 48, 70
BstFNI CGCG 1 cut(s) 151
BstKTI GATC 1 cut(s) 288
BstMBI GATC 1 cut(s) 285
BstMWI GCNNNNNNNGC 2 cut(s) 132, 141
BstNSI RCATGY 1 cut(s) 22
BstUI CGCG 1 cut(s) 151
BsuI GTATCC 1 cut(s) 40
BtgZI GCGATG 1 cut(s) 166
BtsCI GGATG 2 cut(s) 48, 70
BtuMI TCGCGA 1 cut(s) 151
Cac8I GCNNGC 1 cut(s) 54
Csp6I GTAC 1 cut(s) 88
CviAII CATG 4 cut(s) 19, 79, 108, 283
CviJI RGCY 1 cut(s) 126
CviKI_1 RGCY 1 cut(s) 126
CviQI GTAC 1 cut(s) 88
DpnI GATC 1 cut(s) 287
DpnII GATC 1 cut(s) 285
FaeI CATG 4 cut(s) 22, 82, 111, 286
FatI CATG 4 cut(s) 18, 78, 107, 282
FauNDI CATATG 1 cut(s) 250
FokI GGATG 2 cut(s) 55, 77
Hin1II CATG 4 cut(s) 22, 82, 111, 286
HinfI GANTC 4 cut(s) 29, 170, 177, 234
Hpy166II GTNNAC 2 cut(s) 158, 209
Hpy188I TCNGA 1 cut(s) 239
Hpy188III TCNNGA 2 cut(s) 150, 174
Hpy8I GTNNAC 2 cut(s) 158, 209
HpyCH4V TGCA 1 cut(s) 114
HpyF10VI GCNNNNNNNGC 2 cut(s) 132, 141
Hsp92II CATG 4 cut(s) 22, 82, 111, 286
Kzo9I GATC 1 cut(s) 285
LpnPI CCDG 3 cut(s) 158, 187, 263
MalI GATC 1 cut(s) 287
MboI GATC 1 cut(s) 285
MboII GAAGA 1 cut(s) 280
MlyI GAGTC 1 cut(s) 228
MnlI CCTC 2 cut(s) 197, 264
MslI CAYNNNNRTG 2 cut(s) 106, 126
MvnI CGCG 1 cut(s) 151
MwoI GCNNNNNNNGC 2 cut(s) 132, 141
NdeI CATATG 1 cut(s) 250
NdeII GATC 1 cut(s) 285
NlaIII CATG 4 cut(s) 22, 82, 111, 286
NruI TCGCGA 1 cut(s) 151
NspI RCATGY 1 cut(s) 22
PciI ACATGT 1 cut(s) 18
PfeI GAWTC 3 cut(s) 29, 170, 177
PleI GAGTC 1 cut(s) 228
PpsI GAGTC 1 cut(s) 228
PscI ACATGT 1 cut(s) 18
RruI TCGCGA 1 cut(s) 151
RsaI GTAC 1 cut(s) 89
RsaNI GTAC 1 cut(s) 88
RseI CAYNNNNRTG 2 cut(s) 106, 126
Sau3AI GATC 1 cut(s) 285
SchI GAGTC 1 cut(s) 228
SetI ASST 3 cut(s) 100, 128, 208
SmiMI CAYNNNNRTG 2 cut(s) 106, 126
SmlI CTYRAG 1 cut(s) 268
SmoI CTYRAG 1 cut(s) 268
TatI WGTACW 1 cut(s) 87
TfiI GAWTC 3 cut(s) 29, 170, 177
TspDTI ATGAA 6 cut(s) 17, 86, 95, 96, 110, 211
XceI RCATGY 1 cut(s) 22
XcmI CCANNNNNNNNNTGG 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.