Rroxscaffold_5G00336640

Coiled-coil domain-containing protein 94 homolog

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
4467668 .. 4468926
1259 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00336640.1

Sequence Viewer

Length: 165 bp
ATGAAATCTTTGGAGAACATATGCTTGGATTCAAAAAGGGGGATGGATACGCTTGCCACTTTGGATGAGATGAAGTCCATGAAGGACGAGGTGGACTTTTTGAGTTCATTGAAAAACGACTCAGAAAATGGACATATGGTTATTGTGATTGCTGAGGGAGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

5.96

Weight (kDa)

4.5

Isoelectric Point (pI)

25.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 33, 112
AjuI GAANNNNNNNTTGG 2 cut(s) 8, 40
BbvCI CCTCAGC 1 cut(s) 153
BccI CCATC 1 cut(s) 37
BciVI GTATCC 1 cut(s) 40
BfuI GTATCC 1 cut(s) 40
Bpu10I CCTNAGC 1 cut(s) 153
BseGI GGATG 2 cut(s) 48, 70
BseMII CTCAG 2 cut(s) 135, 144
BspCNI CTCAG 2 cut(s) 134, 145
BstC8I GCNNGC 1 cut(s) 54
BstDEI CTNAG 2 cut(s) 121, 153
BstF5I GGATG 2 cut(s) 48, 70
BstMWI GCNNNNNNNGC 1 cut(s) 158
BsuI GTATCC 1 cut(s) 40
BtsCI GGATG 2 cut(s) 48, 70
Cac8I GCNNGC 1 cut(s) 54
CviAII CATG 2 cut(s) 79, 162
DdeI CTNAG 2 cut(s) 121, 153
FaeI CATG 2 cut(s) 82, 165
FaiI YATR 6 cut(s) 20, 22, 80, 135, 137, 163
FatI CATG 2 cut(s) 78, 161
FauNDI CATATG 2 cut(s) 20, 135
FokI GGATG 2 cut(s) 55, 77
Hin1II CATG 2 cut(s) 82, 165
HinfI GANTC 2 cut(s) 29, 119
Hpy166II GTNNAC 1 cut(s) 94
Hpy188I TCNGA 1 cut(s) 124
Hpy8I GTNNAC 1 cut(s) 94
HpyAV CCTTC 1 cut(s) 76
HpyF10VI GCNNNNNNNGC 1 cut(s) 158
HpyF3I CTNAG 2 cut(s) 121, 153
Hsp92II CATG 2 cut(s) 82, 165
LmnI GCTCC 1 cut(s) 158
MlyI GAGTC 1 cut(s) 113
MnlI CCTC 2 cut(s) 82, 148
MwoI GCNNNNNNNGC 1 cut(s) 158
NdeI CATATG 2 cut(s) 20, 135
NlaIII CATG 2 cut(s) 82, 165
PfeI GAWTC 1 cut(s) 29
PleI GAGTC 1 cut(s) 113
PpsI GAGTC 1 cut(s) 113
SchI GAGTC 1 cut(s) 113
SetI ASST 1 cut(s) 93
SgeI CNNG 4 cut(s) 37, 65, 91, 100
TfiI GAWTC 1 cut(s) 29
TspDTI ATGAA 4 cut(s) 17, 86, 95, 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.