RLG00000010537

NADH dehydrogenase ubiquinone iron-sulfur protein 4, mitochondrial-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
OG0002607
Physical Location & Seq
Reverse (-)
2484485 .. 2485799
1315 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000010537

Sequence Viewer

Length: 309 bp
ATGGCAAGCTCTCTACGACACGGATTCACCAAAGCCCGATCACCTATTCTCTCCCGGACCAGATGGTTCTCGTCGGAATCTCAGGCCCTGGTGGAGACCAGGATCCCCGACGTTGGAATCATATCTGGAATCCCGGAACAGCATCTCAAAAGAAGGGAAAATTTCGATGATGGATCAGGTTCTTCCGTAGATTTTACTTCATCAATTGTGCCAAGAGTTATGCAGACAACTTCAAGTGGAAGGGGCTACCGAAGAGCGAGGAGGAGTGAATTTTGCACTTTAGAGATCCCAAAGCTCCGAGGCCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00190 ko01100 ko04714 ko04723 ko04932 ko05010 ko05012 ko05016 map00190 map01100 map04714 map04723 map04932 map05010 map05012 map05016
Pfam Domains
Protein Families
ETC_C1_NDUFA4

Protein Analysis

103

Amino Acids

11.45

Weight (kDa)

11.03

Isoelectric Point (pI)

70.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 4 cut(s) 97, 110, 181, 280
AcsI RAATTY 2 cut(s) 160, 269
AfiI CCNNNNNNNGG 1 cut(s) 113
AgsI TTSAA 1 cut(s) 234
AjnI CCWGG 2 cut(s) 87, 98
AluBI AGCT 2 cut(s) 9, 295
AluI AGCT 2 cut(s) 9, 295
Alw26I GTCTC 1 cut(s) 89
AlwI GGATC 4 cut(s) 97, 110, 181, 280
AlwNI CAGNNNCTG 1 cut(s) 88
AoxI GGCC 2 cut(s) 84, 301
ApoI RAATTY 2 cut(s) 160, 269
AspS9I GGNCC 2 cut(s) 57, 85
AsuC2I CCSGG 2 cut(s) 55, 134
AsuHPI GGTGA 2 cut(s) 19, 33
AvaII GGWCC 1 cut(s) 57
BamHI GGATCC 1 cut(s) 102
BccI CCATC 2 cut(s) 57, 164
BciT130I CCWGG 2 cut(s) 89, 100
BcnI CCSGG 2 cut(s) 55, 134
BcoDI GTCTC 1 cut(s) 89
Bme1390I CCNGG 4 cut(s) 55, 89, 100, 134
Bme18I GGWCC 1 cut(s) 57
BmgT120I GGNCC 2 cut(s) 57, 85
BmiI GGNNCC 1 cut(s) 104
BmrFI CCNGG 4 cut(s) 55, 89, 100, 134
BmsI GCATC 1 cut(s) 151
BpuMI CCSGG 2 cut(s) 55, 134
BsaI GGTCTC 1 cut(s) 89
BsaJI CCNNGG 2 cut(s) 87, 298
Bsc4I CCNNNNNNNGG 1 cut(s) 113
BseBI CCWGG 2 cut(s) 89, 100
BseDI CCNNGG 2 cut(s) 87, 298
BseLI CCNNNNNNNGG 1 cut(s) 113
BseMII CTCAG 1 cut(s) 95
BseRI GAGGAG 2 cut(s) 274, 277
BshFI GGCC 2 cut(s) 86, 303
BsiSI CCGG 2 cut(s) 55, 134
BslI CCNNNNNNNGG 1 cut(s) 113
BsmAI GTCTC 1 cut(s) 89
BsnI GGCC 2 cut(s) 86, 303
Bso31I GGTCTC 1 cut(s) 89
Bsp143I GATC 4 cut(s) 38, 102, 173, 285
BspANI GGCC 2 cut(s) 86, 303
BspCNI CTCAG 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 104
BspPI GGATC 4 cut(s) 97, 110, 181, 280
BspQI GCTCTTC 1 cut(s) 247
BspTNI GGTCTC 1 cut(s) 89
BssECI CCNNGG 2 cut(s) 87, 298
BssMI GATC 4 cut(s) 38, 102, 173, 285
Bst2UI CCWGG 2 cut(s) 89, 100
Bst6I CTCTTC 1 cut(s) 247
BstC8I GCNNGC 1 cut(s) 7
BstDEI CTNAG 1 cut(s) 81
BstKTI GATC 4 cut(s) 41, 105, 176, 288
BstMAI GTCTC 1 cut(s) 89
BstMBI GATC 4 cut(s) 38, 102, 173, 285
BstNI CCWGG 2 cut(s) 89, 100
BstSCI CCNGG 4 cut(s) 53, 87, 98, 132
BstX2I RGATCY 2 cut(s) 102, 285
BstYI RGATCY 2 cut(s) 102, 285
BsuRI GGCC 2 cut(s) 86, 303
Cac8I GCNNGC 1 cut(s) 7
CaiI CAGNNNCTG 1 cut(s) 88
Cfr13I GGNCC 2 cut(s) 57, 85
CviJI RGCY 6 cut(s) 9, 35, 86, 246, 295, 303
CviKI_1 RGCY 6 cut(s) 9, 35, 86, 246, 295, 303
DdeI CTNAG 1 cut(s) 81
DpnI GATC 4 cut(s) 40, 104, 175, 287
DpnII GATC 4 cut(s) 38, 102, 173, 285
Eam1104I CTCTTC 1 cut(s) 247
EarI CTCTTC 1 cut(s) 247
Eco147I AGGCCT 1 cut(s) 303
Eco31I GGTCTC 1 cut(s) 89
Eco47I GGWCC 1 cut(s) 57
EcoO109I RGGNCCY 1 cut(s) 85
EcoRII CCWGG 2 cut(s) 87, 98
FaiI YATR 2 cut(s) 122, 221
HaeIII GGCC 2 cut(s) 86, 303
HapII CCGG 2 cut(s) 55, 134
HinfI GANTC 4 cut(s) 24, 77, 117, 129
HpaII CCGG 2 cut(s) 55, 134
HphI GGTGA 2 cut(s) 19, 33
Hpy188I TCNGA 2 cut(s) 76, 299
Hpy188III TCNNGA 1 cut(s) 126
Hpy99I CGWCG 2 cut(s) 76, 113
HpyAV CCTTC 2 cut(s) 147, 234
HpyCH4IV ACGT 1 cut(s) 111
HpyCH4V TGCA 2 cut(s) 223, 276
HpyF3I CTNAG 1 cut(s) 81
HpySE526I ACGT 1 cut(s) 111
Kzo9I GATC 4 cut(s) 38, 102, 173, 285
LguI GCTCTTC 1 cut(s) 247
LmnI GCTCC 1 cut(s) 300
LweI GCATC 1 cut(s) 151
MaeII ACGT 1 cut(s) 111
MalI GATC 4 cut(s) 40, 104, 175, 287
MboI GATC 4 cut(s) 38, 102, 173, 285
MboII GAAGA 2 cut(s) 174, 264
MfeI CAATTG 1 cut(s) 204
MflI RGATCY 2 cut(s) 102, 285
MluCI AATT 3 cut(s) 160, 204, 269
MmeI TCCRAC 2 cut(s) 54, 94
MnlI CCTC 3 cut(s) 252, 255, 293
MspI CCGG 2 cut(s) 55, 134
MspR9I CCNGG 4 cut(s) 55, 89, 100, 134
MunI CAATTG 1 cut(s) 204
MvaI CCWGG 2 cut(s) 89, 100
NciI CCSGG 2 cut(s) 55, 134
NdeII GATC 4 cut(s) 38, 102, 173, 285
NlaIV GGNNCC 1 cut(s) 104
PceI AGGCCT 1 cut(s) 303
PciSI GCTCTTC 1 cut(s) 247
PfeI GAWTC 4 cut(s) 24, 77, 117, 129
PfoI TCCNGGA 2 cut(s) 53, 132
Psp6I CCWGG 2 cut(s) 87, 98
PspGI CCWGG 2 cut(s) 87, 98
PspN4I GGNNCC 1 cut(s) 104
PspPI GGNCC 2 cut(s) 57, 85
PstNI CAGNNNCTG 1 cut(s) 88
PsuI RGATCY 2 cut(s) 102, 285
SapI GCTCTTC 1 cut(s) 247
Sau3AI GATC 4 cut(s) 38, 102, 173, 285
Sau96I GGNCC 2 cut(s) 57, 85
ScrFI CCNGG 4 cut(s) 55, 89, 100, 134
SetI ASST 5 cut(s) 11, 46, 114, 181, 297
SfaNI GCATC 1 cut(s) 151
SinI GGWCC 1 cut(s) 57
Sse9I AATT 3 cut(s) 160, 204, 269
SseBI AGGCCT 1 cut(s) 303
StuI AGGCCT 1 cut(s) 303
StyD4I CCNGG 4 cut(s) 53, 87, 98, 132
TaiI ACGT 1 cut(s) 114
TaqI TCGA 1 cut(s) 165
TasI AATT 3 cut(s) 160, 204, 269
TfiI GAWTC 4 cut(s) 24, 77, 117, 129
TspDTI ATGAA 1 cut(s) 189
TspGWI ACGGA 2 cut(s) 36, 175
VpaK11BI GGWCC 1 cut(s) 57
XapI RAATTY 2 cut(s) 160, 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.