Rh6BG497500

NADH dehydrogenase ubiquinone iron-sulfur protein 4, mitochondrial-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0002607
Physical Location & Seq
Forward (+)
69837028 .. 69838255
1228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG497500.1

Sequence Viewer

Length: 216 bp
ATGGCAAGCTCTCTACGACACGGATTCACCAAAGCCCGATCACCTATTCTCTCCCGGACCAGATGGTTCTCGTCGGAATCTCAGGCCCTGGTGGAGACCAGGATCCCCGACGTCGGAATCATATCTGGAATCCCCGAACAGCATCTCAAAAGAAGAGTCAAGAGTTATGCAGACAACTTCAAGTGGAAGGGGCTACCAAAGAGCGAGGAGGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00190 ko01100 ko04714 ko04723 ko04932 ko05010 ko05012 ko05016 map00190 map01100 map04714 map04723 map04932 map05010 map05012 map05016
Pfam Domains
Protein Families
ETC_C1_NDUFA4

Protein Analysis

71

Amino Acids

8.14

Weight (kDa)

10.1

Isoelectric Point (pI)

77.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 114
AclWI GGATC 2 cut(s) 97, 110
AcyI GRCGYC 1 cut(s) 111
AfiI CCNNNNNNNGG 1 cut(s) 113
AgsI TTSAA 1 cut(s) 181
AjnI CCWGG 2 cut(s) 87, 98
AluBI AGCT 1 cut(s) 9
AluI AGCT 1 cut(s) 9
Alw26I GTCTC 1 cut(s) 89
AlwI GGATC 2 cut(s) 97, 110
AlwNI CAGNNNCTG 1 cut(s) 88
AoxI GGCC 1 cut(s) 84
ArsI GACNNNNNNTTYG 2 cut(s) 141, 173
AspS9I GGNCC 2 cut(s) 57, 85
AsuC2I CCSGG 1 cut(s) 55
AsuHPI GGTGA 2 cut(s) 19, 33
AvaII GGWCC 1 cut(s) 57
BamHI GGATCC 1 cut(s) 102
BccI CCATC 1 cut(s) 57
BciT130I CCWGG 2 cut(s) 89, 100
BcnI CCSGG 1 cut(s) 55
BcoDI GTCTC 1 cut(s) 89
Bme1390I CCNGG 3 cut(s) 55, 89, 100
Bme18I GGWCC 1 cut(s) 57
BmgT120I GGNCC 2 cut(s) 57, 85
BmiI GGNNCC 1 cut(s) 104
BmrFI CCNGG 3 cut(s) 55, 89, 100
BmsI GCATC 1 cut(s) 151
BpuMI CCSGG 1 cut(s) 55
BsaHI GRCGYC 1 cut(s) 111
BsaI GGTCTC 1 cut(s) 89
BsaJI CCNNGG 1 cut(s) 87
Bsc4I CCNNNNNNNGG 1 cut(s) 113
BseBI CCWGG 2 cut(s) 89, 100
BseDI CCNNGG 1 cut(s) 87
BseLI CCNNNNNNNGG 1 cut(s) 113
BseMII CTCAG 1 cut(s) 95
BshFI GGCC 1 cut(s) 86
BsiSI CCGG 1 cut(s) 55
BslI CCNNNNNNNGG 1 cut(s) 113
BsmAI GTCTC 1 cut(s) 89
BsnI GGCC 1 cut(s) 86
Bso31I GGTCTC 1 cut(s) 89
Bsp143I GATC 2 cut(s) 38, 102
BspANI GGCC 1 cut(s) 86
BspCNI CTCAG 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 104
BspPI GGATC 2 cut(s) 97, 110
BspTNI GGTCTC 1 cut(s) 89
BssECI CCNNGG 1 cut(s) 87
BssMI GATC 2 cut(s) 38, 102
BssNI GRCGYC 1 cut(s) 111
Bst2UI CCWGG 2 cut(s) 89, 100
Bst6I CTCTTC 1 cut(s) 148
BstACI GRCGYC 1 cut(s) 111
BstC8I GCNNGC 1 cut(s) 7
BstDEI CTNAG 1 cut(s) 81
BstKTI GATC 2 cut(s) 41, 105
BstMAI GTCTC 1 cut(s) 89
BstMBI GATC 2 cut(s) 38, 102
BstNI CCWGG 2 cut(s) 89, 100
BstSCI CCNGG 3 cut(s) 53, 87, 98
BstX2I RGATCY 1 cut(s) 102
BstYI RGATCY 1 cut(s) 102
BsuRI GGCC 1 cut(s) 86
Cac8I GCNNGC 1 cut(s) 7
CaiI CAGNNNCTG 1 cut(s) 88
Cfr13I GGNCC 2 cut(s) 57, 85
CviJI RGCY 4 cut(s) 9, 35, 86, 193
CviKI_1 RGCY 4 cut(s) 9, 35, 86, 193
DdeI CTNAG 1 cut(s) 81
DpnI GATC 2 cut(s) 40, 104
DpnII GATC 2 cut(s) 38, 102
Eam1104I CTCTTC 1 cut(s) 148
EarI CTCTTC 1 cut(s) 148
Eco31I GGTCTC 1 cut(s) 89
Eco47I GGWCC 1 cut(s) 57
EcoO109I RGGNCCY 1 cut(s) 85
EcoRII CCWGG 2 cut(s) 87, 98
FaiI YATR 2 cut(s) 122, 168
HaeIII GGCC 1 cut(s) 86
HapII CCGG 1 cut(s) 55
Hin1I GRCGYC 1 cut(s) 111
HinfI GANTC 5 cut(s) 24, 77, 117, 129, 156
HpaII CCGG 1 cut(s) 55
HphI GGTGA 2 cut(s) 19, 33
Hpy188I TCNGA 2 cut(s) 76, 116
Hpy188III TCNNGA 2 cut(s) 126, 160
Hpy99I CGWCG 3 cut(s) 76, 113, 116
HpyAV CCTTC 1 cut(s) 181
HpyCH4IV ACGT 1 cut(s) 111
HpyCH4V TGCA 1 cut(s) 170
HpyF3I CTNAG 1 cut(s) 81
HpySE526I ACGT 1 cut(s) 111
Hsp92I GRCGYC 1 cut(s) 111
Kzo9I GATC 2 cut(s) 38, 102
LpnPI CCDG 8 cut(s) 68, 68, 73, 74, 85, 101, 111, 112
LweI GCATC 1 cut(s) 151
MaeII ACGT 1 cut(s) 111
MalI GATC 2 cut(s) 40, 104
MboI GATC 2 cut(s) 38, 102
MboII GAAGA 1 cut(s) 165
MflI RGATCY 1 cut(s) 102
MlyI GAGTC 1 cut(s) 165
MmeI TCCRAC 2 cut(s) 54, 94
MnlI CCTC 2 cut(s) 199, 202
MspI CCGG 1 cut(s) 55
MspR9I CCNGG 3 cut(s) 55, 89, 100
MvaI CCWGG 2 cut(s) 89, 100
NciI CCSGG 1 cut(s) 55
NdeII GATC 2 cut(s) 38, 102
NlaIV GGNNCC 1 cut(s) 104
PfeI GAWTC 4 cut(s) 24, 77, 117, 129
PfoI TCCNGGA 1 cut(s) 53
PleI GAGTC 1 cut(s) 164
PpsI GAGTC 1 cut(s) 164
Psp6I CCWGG 2 cut(s) 87, 98
PspGI CCWGG 2 cut(s) 87, 98
PspN4I GGNNCC 1 cut(s) 104
PspPI GGNCC 2 cut(s) 57, 85
PstNI CAGNNNCTG 1 cut(s) 88
PsuI RGATCY 1 cut(s) 102
Sau3AI GATC 2 cut(s) 38, 102
Sau96I GGNCC 2 cut(s) 57, 85
SchI GAGTC 1 cut(s) 165
ScrFI CCNGG 3 cut(s) 55, 89, 100
SetI ASST 3 cut(s) 11, 46, 114
SfaNI GCATC 1 cut(s) 151
SinI GGWCC 1 cut(s) 57
StyD4I CCNGG 3 cut(s) 53, 87, 98
TaiI ACGT 1 cut(s) 114
TfiI GAWTC 4 cut(s) 24, 77, 117, 129
TspGWI ACGGA 1 cut(s) 36
VpaK11BI GGWCC 1 cut(s) 57
ZraI GACGTC 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.