RLG00000030277

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr6
OG0005905
Physical Location & Seq
Forward (+)
58805216 .. 58806786
1571 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000030277

Sequence Viewer

Length: 453 bp
ATGTTGTTACCCCCTGGTTCTTTTATTGCAGAAGTGTCAGACAAAGTGGCCAGCAAGGGATTTTCAGTAGAAGACAAGGAGATACTCGAGAAGCAGATGCATGGCATGGCTGTAGTGATTGAGAAATTGGAAAGCAGTAGACAAAAGGTTTTAATGGAGATTGATTCCCAATCTTTGGAGATAGAAAGGCTATTTGAGGAAAACTCTAATTTATCTAGTTCTCTTCAGGAGAATCAGGTGAAAGACTATCTTAAGCAAAATGAAGCACTCCGAGGAATCTTAGATAAGTTAAGAACTGACCAGGCCAGGGGGATGCTCGACTCCCATCATAATGGCTCTGACAAGACTGGTTTAGCTGAATATACACCTGAAGTTCTCTCTATCAAGGATCAACTTGCAAAAGAACAAAGCAAAGCAGAGGCATTATTAGCTGTTGTATATGGAGAAGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

151

Amino Acids

16.73

Weight (kDa)

4.87

Isoelectric Point (pI)

49.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 175
AccI GTMKAC 1 cut(s) 139
AclWI GGATC 1 cut(s) 396
AcoI YGGCCR 1 cut(s) 48
AcuI CTGAAG 2 cut(s) 209, 390
AfiI CCNNNNNNNGG 2 cut(s) 175, 307
AflII CTTAAG 1 cut(s) 251
AjnI CCWGG 3 cut(s) 13, 300, 305
AluBI AGCT 2 cut(s) 356, 431
AluI AGCT 2 cut(s) 356, 431
AlwI GGATC 1 cut(s) 396
Ama87I CYCGRG 1 cut(s) 86
AoxI GGCC 2 cut(s) 48, 303
AsuHPI GGTGA 1 cut(s) 250
AvaI CYCGRG 1 cut(s) 86
BalI TGGCCA 1 cut(s) 50
BbsI GAAGAC 1 cut(s) 78
BccI CCATC 1 cut(s) 333
BciT130I CCWGG 3 cut(s) 15, 302, 307
BfaI CTAG 1 cut(s) 216
BfmI CTRYAG 1 cut(s) 111
BfrI CTTAAG 1 cut(s) 251
Bme1390I CCNGG 3 cut(s) 15, 302, 307
BmeT110I CYCGRG 1 cut(s) 86
BmrFI CCNGG 3 cut(s) 15, 302, 307
BmsI GCATC 2 cut(s) 87, 303
BpiI GAAGAC 1 cut(s) 78
BplI GAGNNNNNCTC 2 cut(s) 188, 220
BsaJI CCNNGG 3 cut(s) 13, 271, 306
Bsc4I CCNNNNNNNGG 2 cut(s) 175, 307
Bse1I ACTGG 1 cut(s) 352
BseBI CCWGG 3 cut(s) 15, 302, 307
BseDI CCNNGG 3 cut(s) 13, 271, 306
BseGI GGATG 1 cut(s) 318
BseLI CCNNNNNNNGG 2 cut(s) 175, 307
BseNI ACTGG 1 cut(s) 352
BshFI GGCC 2 cut(s) 50, 305
BsiHKCI CYCGRG 1 cut(s) 86
BslI CCNNNNNNNGG 2 cut(s) 175, 307
BsnI GGCC 2 cut(s) 50, 305
BsoBI CYCGRG 1 cut(s) 86
Bsp143I GATC 1 cut(s) 388
BspANI GGCC 2 cut(s) 50, 305
BspPI GGATC 1 cut(s) 396
BspTI CTTAAG 1 cut(s) 251
BsrI ACTGG 1 cut(s) 352
BssECI CCNNGG 3 cut(s) 13, 271, 306
BssMI GATC 1 cut(s) 388
Bst2UI CCWGG 3 cut(s) 15, 302, 307
Bst6I CTCTTC 1 cut(s) 228
BstAFI CTTAAG 1 cut(s) 251
BstC8I GCNNGC 1 cut(s) 52
BstDEI CTNAG 1 cut(s) 280
BstF5I GGATG 1 cut(s) 318
BstKTI GATC 1 cut(s) 391
BstMBI GATC 1 cut(s) 388
BstMWI GCNNNNNNNGC 1 cut(s) 428
BstNI CCWGG 3 cut(s) 15, 302, 307
BstSCI CCNGG 3 cut(s) 13, 300, 305
BstSFI CTRYAG 1 cut(s) 111
BstV2I GAAGAC 1 cut(s) 78
BstXI CCANNNNNNTGG 1 cut(s) 332
BsuRI GGCC 2 cut(s) 50, 305
BtsCI GGATG 1 cut(s) 318
Cac8I GCNNGC 1 cut(s) 52
CviAII CATG 2 cut(s) 101, 106
CviJI RGCY 7 cut(s) 50, 110, 190, 305, 336, 356, 431
CviKI_1 RGCY 7 cut(s) 50, 110, 190, 305, 336, 356, 431
DdeI CTNAG 1 cut(s) 280
DpnI GATC 1 cut(s) 390
DpnII GATC 1 cut(s) 388
EaeI YGGCCR 1 cut(s) 48
Eam1104I CTCTTC 1 cut(s) 228
EarI CTCTTC 1 cut(s) 228
Eco57I CTGAAG 2 cut(s) 209, 390
Eco88I CYCGRG 1 cut(s) 86
EcoRII CCWGG 3 cut(s) 13, 300, 305
EcoT22I ATGCAT 1 cut(s) 102
FaeI CATG 2 cut(s) 104, 109
FaiI YATR 6 cut(s) 102, 107, 330, 363, 439, 441
FalI AAGNNNNNCTT 2 cut(s) 234, 266
FatI CATG 2 cut(s) 100, 105
FblI GTMKAC 1 cut(s) 139
FokI GGATG 1 cut(s) 325
FspBI CTAG 1 cut(s) 216
HaeIII GGCC 2 cut(s) 50, 305
Hin1II CATG 2 cut(s) 104, 109
HinfI GANTC 4 cut(s) 164, 232, 276, 320
HphI GGTGA 1 cut(s) 250
Hpy166II GTNNAC 1 cut(s) 140
Hpy188I TCNGA 3 cut(s) 40, 272, 340
Hpy188III TCNNGA 2 cut(s) 88, 227
Hpy8I GTNNAC 1 cut(s) 140
HpyCH4V TGCA 3 cut(s) 29, 100, 398
HpyF10VI GCNNNNNNNGC 1 cut(s) 428
HpyF3I CTNAG 1 cut(s) 280
Hsp92II CATG 2 cut(s) 104, 109
Kzo9I GATC 1 cut(s) 388
LweI GCATC 2 cut(s) 87, 303
MaeI CTAG 1 cut(s) 216
MaeIII GTNAC 1 cut(s) 6
MalI GATC 1 cut(s) 390
MboI GATC 1 cut(s) 388
MboII GAAGA 2 cut(s) 83, 215
MlsI TGGCCA 1 cut(s) 50
MluCI AATT 2 cut(s) 125, 208
MluNI TGGCCA 1 cut(s) 50
MlyI GAGTC 1 cut(s) 314
MnlI CCTC 3 cut(s) 190, 266, 412
Mox20I TGGCCA 1 cut(s) 50
Mph1103I ATGCAT 1 cut(s) 102
MscI TGGCCA 1 cut(s) 50
MseI TTAA 3 cut(s) 152, 252, 290
MslI CAYNNNNRTG 1 cut(s) 330
Msp20I TGGCCA 1 cut(s) 50
MspCI CTTAAG 1 cut(s) 251
MspR9I CCNGG 3 cut(s) 15, 302, 307
MvaI CCWGG 3 cut(s) 15, 302, 307
MwoI GCNNNNNNNGC 1 cut(s) 428
NdeII GATC 1 cut(s) 388
NlaIII CATG 2 cut(s) 104, 109
NsiI ATGCAT 1 cut(s) 102
PaeR7I CTCGAG 1 cut(s) 86
PfeI GAWTC 3 cut(s) 164, 232, 276
PflMI CCANNNNNTGG 1 cut(s) 175
PleI GAGTC 1 cut(s) 314
PpsI GAGTC 1 cut(s) 314
Psp6I CCWGG 3 cut(s) 13, 300, 305
PspGI CCWGG 3 cut(s) 13, 300, 305
RseI CAYNNNNRTG 1 cut(s) 330
SaqAI TTAA 3 cut(s) 152, 252, 290
Sau3AI GATC 1 cut(s) 388
SchI GAGTC 1 cut(s) 314
ScrFI CCNGG 3 cut(s) 15, 302, 307
SetI ASST 5 cut(s) 150, 240, 358, 370, 433
SfaNI GCATC 2 cut(s) 87, 303
SfcI CTRYAG 1 cut(s) 111
Sfr274I CTCGAG 1 cut(s) 86
SlaI CTCGAG 1 cut(s) 86
SmiMI CAYNNNNRTG 1 cut(s) 330
SmlI CTYRAG 2 cut(s) 86, 251
SmoI CTYRAG 2 cut(s) 86, 251
Sse9I AATT 2 cut(s) 125, 208
SspMI CTAG 1 cut(s) 216
StyD4I CCNGG 3 cut(s) 13, 300, 305
TaqI TCGA 2 cut(s) 87, 318
TasI AATT 2 cut(s) 125, 208
TfiI GAWTC 3 cut(s) 164, 232, 276
Tru1I TTAA 3 cut(s) 152, 252, 290
Tru9I TTAA 3 cut(s) 152, 252, 290
TspDTI ATGAA 1 cut(s) 276
Van91I CCANNNNNTGG 1 cut(s) 175
Vha464I CTTAAG 1 cut(s) 251
XhoI CTCGAG 1 cut(s) 86
XmiI GTMKAC 1 cut(s) 139
XspI CTAG 1 cut(s) 216
Zsp2I ATGCAT 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.