Rh3CG354000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
OG0005905
Physical Location & Seq
Reverse (-)
43135693 .. 43137803
2111 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG354000.1

Sequence Viewer

Length: 417 bp
ATGGCTTCGAGAGTCGTTGATCAACAACAAGCCAGAGGAAGACAAGGAGATACTCGAGAAGCAGATGCATGGCATGGCTGTATGATTGAGAAATTGGAAAGCAGTAGACAAAAGCTTTTAATGAAGATTGATTCCCAATCTTCGGAGATAGAAAGGCTATTTGAGGAAAACTCTAATTTATCTAGTTCTCTTCAGGAGGCTATAAGTATAGCTCTGTACTGGGAGAATCAGTATTATTTGGCGCAAAGTGAAGCGCTCCGAGGAATCTTAGATAAGTTAAGAACTGACCAGGCCAAGGGGTTGCTCAACTCCCATCATAATGGCTCTATCAAGGTTGATATTGCTGATAAGGATCAACTTGCAAAAGAACAGAGCAAAGCAGAGGCATTATCAGCTGTTGTATATGGAGAAGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

138

Amino Acids

15.51

Weight (kDa)

5.22

Isoelectric Point (pI)

50.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 106
AclWI GGATC 1 cut(s) 360
AcuI CTGAAG 1 cut(s) 176
AfaI GTAC 1 cut(s) 218
AfeI AGCGCT 1 cut(s) 255
AfiI CCNNNNNNNGG 2 cut(s) 142, 295
AjnI CCWGG 1 cut(s) 288
AluBI AGCT 3 cut(s) 115, 212, 395
AluI AGCT 3 cut(s) 115, 212, 395
AlwI GGATC 1 cut(s) 360
Ama87I CYCGRG 1 cut(s) 54
Aor51HI AGCGCT 1 cut(s) 255
AoxI GGCC 1 cut(s) 291
AspLEI GCGC 2 cut(s) 244, 256
AvaI CYCGRG 1 cut(s) 54
BbsI GAAGAC 1 cut(s) 46
BccI CCATC 1 cut(s) 321
BciT130I CCWGG 1 cut(s) 290
BclI TGATCA 1 cut(s) 19
BfaI CTAG 1 cut(s) 183
BfoI RGCGCY 1 cut(s) 257
Bme1390I CCNGG 1 cut(s) 290
BmeT110I CYCGRG 1 cut(s) 54
BmrFI CCNGG 1 cut(s) 290
BmrI ACTGGG 1 cut(s) 229
BmsI GCATC 1 cut(s) 55
BmuI ACTGGG 1 cut(s) 229
BpiI GAAGAC 1 cut(s) 46
BplI GAGNNNNNCTC 2 cut(s) 155, 187
BsaBI GATNNNNATC 1 cut(s) 351
BsaJI CCNNGG 2 cut(s) 259, 294
BsaXI ACNNNNNCTCC 2 cut(s) 215, 245
Bsc4I CCNNNNNNNGG 2 cut(s) 142, 295
Bse1I ACTGG 1 cut(s) 224
Bse8I GATNNNNATC 1 cut(s) 351
BseBI CCWGG 1 cut(s) 290
BseDI CCNNGG 2 cut(s) 259, 294
BseJI GATNNNNATC 1 cut(s) 351
BseLI CCNNNNNNNGG 2 cut(s) 142, 295
BseNI ACTGG 1 cut(s) 224
BshFI GGCC 1 cut(s) 293
BsiHKCI CYCGRG 1 cut(s) 54
BslI CCNNNNNNNGG 2 cut(s) 142, 295
BsnI GGCC 1 cut(s) 293
BsoBI CYCGRG 1 cut(s) 54
Bsp143I GATC 2 cut(s) 19, 352
BspANI GGCC 1 cut(s) 293
BspPI GGATC 1 cut(s) 360
BsrI ACTGG 1 cut(s) 224
BssECI CCNNGG 2 cut(s) 259, 294
BssMI GATC 2 cut(s) 19, 352
BssT1I CCWWGG 1 cut(s) 294
Bst2UI CCWGG 1 cut(s) 290
Bst6I CTCTTC 1 cut(s) 195
BstDEI CTNAG 1 cut(s) 268
BstH2I RGCGCY 1 cut(s) 257
BstHHI GCGC 2 cut(s) 244, 256
BstKTI GATC 2 cut(s) 22, 355
BstMBI GATC 2 cut(s) 19, 352
BstMWI GCNNNNNNNGC 1 cut(s) 392
BstNI CCWGG 1 cut(s) 290
BstSCI CCNGG 1 cut(s) 288
BstV2I GAAGAC 1 cut(s) 46
BstXI CCANNNNNNTGG 1 cut(s) 320
BsuRI GGCC 1 cut(s) 293
CfoI GCGC 2 cut(s) 244, 256
Csp6I GTAC 1 cut(s) 217
CviAII CATG 2 cut(s) 69, 74
CviQI GTAC 1 cut(s) 217
DdeI CTNAG 1 cut(s) 268
DpnI GATC 2 cut(s) 21, 354
DpnII GATC 2 cut(s) 19, 352
Eam1104I CTCTTC 1 cut(s) 195
EarI CTCTTC 1 cut(s) 195
Eco130I CCWWGG 1 cut(s) 294
Eco47III AGCGCT 1 cut(s) 255
Eco57I CTGAAG 1 cut(s) 176
Eco88I CYCGRG 1 cut(s) 54
EcoRII CCWGG 1 cut(s) 288
EcoT14I CCWWGG 1 cut(s) 294
EcoT22I ATGCAT 1 cut(s) 70
ErhI CCWWGG 1 cut(s) 294
FaeI CATG 2 cut(s) 72, 77
FaiI YATR 8 cut(s) 70, 75, 83, 203, 209, 318, 403, 405
FatI CATG 2 cut(s) 68, 73
FbaI TGATCA 1 cut(s) 19
FblI GTMKAC 1 cut(s) 106
FspBI CTAG 1 cut(s) 183
GlaI GCGC 2 cut(s) 243, 255
HaeII RGCGCY 1 cut(s) 257
HaeIII GGCC 1 cut(s) 293
HhaI GCGC 2 cut(s) 244, 256
Hin1II CATG 2 cut(s) 72, 77
Hin6I GCGC 2 cut(s) 242, 254
HinP1I GCGC 2 cut(s) 242, 254
HindIII AAGCTT 1 cut(s) 113
HinfI GANTC 4 cut(s) 12, 131, 226, 264
Hpy166II GTNNAC 1 cut(s) 107
Hpy188I TCNGA 2 cut(s) 145, 260
Hpy188III TCNNGA 3 cut(s) 9, 56, 194
Hpy8I GTNNAC 1 cut(s) 107
HpyCH4V TGCA 2 cut(s) 68, 362
HpyF10VI GCNNNNNNNGC 1 cut(s) 392
HpyF3I CTNAG 1 cut(s) 268
Hsp92II CATG 2 cut(s) 72, 77
HspAI GCGC 2 cut(s) 242, 254
Ksp22I TGATCA 1 cut(s) 19
Kzo9I GATC 2 cut(s) 19, 352
LmnI GCTCC 1 cut(s) 261
LpnPI CCDG 5 cut(s) 46, 179, 205, 275, 302
LweI GCATC 1 cut(s) 55
MaeI CTAG 1 cut(s) 183
MalI GATC 2 cut(s) 21, 354
MboI GATC 2 cut(s) 19, 352
MboII GAAGA 4 cut(s) 51, 132, 136, 182
MluCI AATT 2 cut(s) 92, 175
MlyI GAGTC 1 cut(s) 21
MnlI CCTC 5 cut(s) 29, 157, 190, 254, 376
Mph1103I ATGCAT 1 cut(s) 70
MseI TTAA 2 cut(s) 119, 278
MslI CAYNNNNRTG 1 cut(s) 318
MspA1I CMGCKG 1 cut(s) 395
MspR9I CCNGG 1 cut(s) 290
MvaI CCWGG 1 cut(s) 290
MwoI GCNNNNNNNGC 1 cut(s) 392
NdeII GATC 2 cut(s) 19, 352
NlaIII CATG 2 cut(s) 72, 77
NsiI ATGCAT 1 cut(s) 70
PaeR7I CTCGAG 1 cut(s) 54
PfeI GAWTC 3 cut(s) 131, 226, 264
PleI GAGTC 1 cut(s) 20
PpsI GAGTC 1 cut(s) 20
Psp6I CCWGG 1 cut(s) 288
PspGI CCWGG 1 cut(s) 288
PvuII CAGCTG 1 cut(s) 395
RsaI GTAC 1 cut(s) 218
RsaNI GTAC 1 cut(s) 217
RseI CAYNNNNRTG 1 cut(s) 318
SaqAI TTAA 2 cut(s) 119, 278
Sau3AI GATC 2 cut(s) 19, 352
SchI GAGTC 1 cut(s) 21
ScrFI CCNGG 1 cut(s) 290
SetI ASST 4 cut(s) 117, 214, 336, 397
SfaNI GCATC 1 cut(s) 55
Sfr274I CTCGAG 1 cut(s) 54
SlaI CTCGAG 1 cut(s) 54
SmiMI CAYNNNNRTG 1 cut(s) 318
SmlI CTYRAG 1 cut(s) 54
SmoI CTYRAG 1 cut(s) 54
Sse9I AATT 2 cut(s) 92, 175
SspMI CTAG 1 cut(s) 183
StyD4I CCNGG 1 cut(s) 288
StyI CCWWGG 1 cut(s) 294
TaqI TCGA 2 cut(s) 8, 55
TasI AATT 2 cut(s) 92, 175
TatI WGTACW 1 cut(s) 216
TfiI GAWTC 3 cut(s) 131, 226, 264
Tru1I TTAA 2 cut(s) 119, 278
Tru9I TTAA 2 cut(s) 119, 278
TspDTI ATGAA 1 cut(s) 137
XhoI CTCGAG 1 cut(s) 54
XmiI GTMKAC 1 cut(s) 106
XspI CTAG 1 cut(s) 183
Zsp2I ATGCAT 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.