Rw3G028160

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr3
OG0005905
Physical Location & Seq
Reverse (-)
41317964 .. 41318780
817 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw3G028160.1

Sequence Viewer

Length: 273 bp
ATGGTTGGCTGCTTTACCTCACAGCAATATCGTATTCTTCCTTACAGAGACTTCATCCGGGAAGACAAGGAGATACTCGAGAAGCAGATGCATGGCATGGCTGTAGTGATTGAGAAATTGGAAAGCAGTAGACAAAAGCTTTTAATGAAGATTGATTCCCAATCTTCGGAGATAGAAAGGCTATTTGAGGAAAACTCTAATTTATCTAGTTCTCTTAAGGAGGCTATGAGTATAGCTCTGCACTGGGAGAATCAGTATTATTTGGCGGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.63

Weight (kDa)

5.35

Isoelectric Point (pI)

69.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 130
AciI CCGC 1 cut(s) 266
AfiI CCNNNNNNNGG 1 cut(s) 166
AflII CTTAAG 1 cut(s) 215
AluBI AGCT 2 cut(s) 139, 236
AluI AGCT 2 cut(s) 139, 236
Alw26I GTCTC 1 cut(s) 42
Ama87I CYCGRG 1 cut(s) 77
ApeKI GCWGC 1 cut(s) 9
AsuC2I CCSGG 1 cut(s) 59
AvaI CYCGRG 1 cut(s) 77
BbsI GAAGAC 1 cut(s) 69
BcnI CCSGG 1 cut(s) 59
BcoDI GTCTC 1 cut(s) 42
BfaI CTAG 1 cut(s) 207
BfmI CTRYAG 1 cut(s) 102
BfrI CTTAAG 1 cut(s) 215
BisI GCNGC 1 cut(s) 10
BlsI GCNGC 1 cut(s) 11
Bme1390I CCNGG 1 cut(s) 59
BmeT110I CYCGRG 1 cut(s) 77
BmrFI CCNGG 1 cut(s) 59
BmrI ACTGGG 1 cut(s) 253
BmsI GCATC 1 cut(s) 78
BmuI ACTGGG 1 cut(s) 253
BpiI GAAGAC 1 cut(s) 69
BplI GAGNNNNNCTC 4 cut(s) 179, 211, 220, 252
BpuMI CCSGG 1 cut(s) 59
BsaXI ACNNNNNCTCC 2 cut(s) 239, 269
Bsc4I CCNNNNNNNGG 1 cut(s) 166
Bse1I ACTGG 1 cut(s) 248
BseGI GGATG 1 cut(s) 54
BseLI CCNNNNNNNGG 1 cut(s) 166
BseNI ACTGG 1 cut(s) 248
BsgI GTGCAG 1 cut(s) 224
BsiHKCI CYCGRG 1 cut(s) 77
BsiSI CCGG 1 cut(s) 58
BslI CCNNNNNNNGG 1 cut(s) 166
BsmAI GTCTC 1 cut(s) 42
BsoBI CYCGRG 1 cut(s) 77
BspACI CCGC 1 cut(s) 266
BspTI CTTAAG 1 cut(s) 215
BsrI ACTGG 1 cut(s) 248
BstAFI CTTAAG 1 cut(s) 215
BstF5I GGATG 1 cut(s) 54
BstMAI GTCTC 1 cut(s) 42
BstSCI CCNGG 1 cut(s) 57
BstSFI CTRYAG 1 cut(s) 102
BstV2I GAAGAC 1 cut(s) 69
BtsCI GGATG 1 cut(s) 54
BtsIMutI CAGTG 1 cut(s) 241
CviAII CATG 2 cut(s) 92, 97
CviJI RGCY 6 cut(s) 9, 101, 139, 181, 224, 236
CviKI_1 RGCY 6 cut(s) 9, 101, 139, 181, 224, 236
Eco88I CYCGRG 1 cut(s) 77
EcoT22I ATGCAT 1 cut(s) 93
FaeI CATG 2 cut(s) 95, 100
FaiI YATR 4 cut(s) 93, 98, 227, 233
FatI CATG 2 cut(s) 91, 96
FblI GTMKAC 1 cut(s) 130
Fnu4HI GCNGC 1 cut(s) 10
FokI GGATG 1 cut(s) 41
Fsp4HI GCNGC 1 cut(s) 10
FspBI CTAG 1 cut(s) 207
GluI GCNGC 1 cut(s) 10
HapII CCGG 1 cut(s) 58
Hin1II CATG 2 cut(s) 95, 100
HindIII AAGCTT 1 cut(s) 137
HinfI GANTC 2 cut(s) 155, 250
HpaII CCGG 1 cut(s) 58
Hpy166II GTNNAC 1 cut(s) 131
Hpy188I TCNGA 1 cut(s) 169
Hpy188III TCNNGA 1 cut(s) 79
Hpy8I GTNNAC 1 cut(s) 131
HpyCH4V TGCA 2 cut(s) 91, 241
Hsp92II CATG 2 cut(s) 95, 100
LpnPI CCDG 2 cut(s) 71, 229
LweI GCATC 1 cut(s) 78
MaeI CTAG 1 cut(s) 207
MboII GAAGA 4 cut(s) 29, 74, 156, 160
MluCI AATT 2 cut(s) 116, 199
MnlI CCTC 3 cut(s) 28, 181, 214
Mph1103I ATGCAT 1 cut(s) 93
MseI TTAA 2 cut(s) 143, 216
MspCI CTTAAG 1 cut(s) 215
MspI CCGG 1 cut(s) 58
MspR9I CCNGG 1 cut(s) 59
NciI CCSGG 1 cut(s) 59
NlaIII CATG 2 cut(s) 95, 100
NsiI ATGCAT 1 cut(s) 93
PaeR7I CTCGAG 1 cut(s) 77
PfeI GAWTC 2 cut(s) 155, 250
PfoI TCCNGGA 1 cut(s) 57
PkrI GCNGC 1 cut(s) 11
SaqAI TTAA 2 cut(s) 143, 216
SatI GCNGC 1 cut(s) 10
ScrFI CCNGG 1 cut(s) 59
SetI ASST 3 cut(s) 20, 141, 238
SfaNI GCATC 1 cut(s) 78
SfcI CTRYAG 1 cut(s) 102
Sfr274I CTCGAG 1 cut(s) 77
SgeI CNNG 9 cut(s) 70, 71, 79, 89, 91, 104, 109, 219, 256
SlaI CTCGAG 1 cut(s) 77
SmlI CTYRAG 2 cut(s) 77, 215
SmoI CTYRAG 2 cut(s) 77, 215
Sse9I AATT 2 cut(s) 116, 199
SsiI CCGC 1 cut(s) 266
SspMI CTAG 1 cut(s) 207
StyD4I CCNGG 1 cut(s) 57
TaqI TCGA 1 cut(s) 78
TasI AATT 2 cut(s) 116, 199
TfiI GAWTC 2 cut(s) 155, 250
Tru1I TTAA 2 cut(s) 143, 216
Tru9I TTAA 2 cut(s) 143, 216
TscAI CASTG 1 cut(s) 248
TseI GCWGC 1 cut(s) 9
TspDTI ATGAA 2 cut(s) 43, 161
TspRI CASTG 1 cut(s) 248
Vha464I CTTAAG 1 cut(s) 215
XhoI CTCGAG 1 cut(s) 77
XmiI GTMKAC 1 cut(s) 130
XspI CTAG 1 cut(s) 207
Zsp2I ATGCAT 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.