Rmu_co7995176.1_g000001

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co7995176.1
Physical Location & Seq
Reverse (-)
1 .. 480
480 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co7995176.1_g000001.1.cds

Sequence Viewer

Length: 257 bp
atgattaaagacttgaaatctgcagggtattcacctgatacgtccgaggtttttcttgatgtaggggaagagaataaagagagtgcagtttataagcacagtgagaagttagcaattgcgtttggattgattagtttaggacctggggtgactattagagtcatgaagaacctcagaatctgcgtggattgtcacagcatggcaaagctggtttccaaggtgtatgatagagaagtgattgttagggatggaactcg

Protein Analysis

86

Amino Acids

9.53

Weight (kDa)

7.78

Isoelectric Point (pI)

19.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 93
AgsI TTSAA 1 cut(s) 16
AjnI CCWGG 1 cut(s) 142
AluBI AGCT 1 cut(s) 208
AluI AGCT 1 cut(s) 208
AlwNI CAGNNNCTG 1 cut(s) 180
AspS9I GGNCC 1 cut(s) 140
AsuHPI GGTGA 2 cut(s) 24, 160
AvaII GGWCC 1 cut(s) 140
BccI CCATC 1 cut(s) 242
BciT130I CCWGG 1 cut(s) 144
BfmI CTRYAG 1 cut(s) 21
Bme1390I CCNGG 1 cut(s) 144
Bme18I GGWCC 1 cut(s) 140
BmgT120I GGNCC 1 cut(s) 140
BmrFI CCNGG 1 cut(s) 144
BsaJI CCNNGG 3 cut(s) 45, 143, 216
BseBI CCWGG 1 cut(s) 144
BseDI CCNNGG 3 cut(s) 45, 143, 216
BseGI GGATG 1 cut(s) 253
BseMII CTCAG 1 cut(s) 187
BsgI GTGCAG 1 cut(s) 105
BspCNI CTCAG 1 cut(s) 186
BspHI TCATGA 1 cut(s) 162
BspMAI CTGCAG 1 cut(s) 25
BssECI CCNNGG 3 cut(s) 45, 143, 216
BssT1I CCWWGG 1 cut(s) 216
Bst2UI CCWGG 1 cut(s) 144
Bst4CI ACNGT 1 cut(s) 101
Bst6I CTCTTC 1 cut(s) 63
BstDEI CTNAG 1 cut(s) 173
BstF5I GGATG 1 cut(s) 253
BstNI CCWGG 1 cut(s) 144
BstSCI CCNGG 1 cut(s) 142
BstSFI CTRYAG 1 cut(s) 21
BtsCI GGATG 1 cut(s) 253
BtsIMutI CAGTG 1 cut(s) 106
CaiI CAGNNNCTG 1 cut(s) 180
CciI TCATGA 1 cut(s) 162
Cfr13I GGNCC 1 cut(s) 140
CviAII CATG 2 cut(s) 163, 199
CviJI RGCY 1 cut(s) 208
CviKI_1 RGCY 1 cut(s) 208
DdeI CTNAG 1 cut(s) 173
Eam1104I CTCTTC 1 cut(s) 63
EarI CTCTTC 1 cut(s) 63
Eco130I CCWWGG 1 cut(s) 216
Eco47I GGWCC 1 cut(s) 140
EcoO109I RGGNCCY 1 cut(s) 140
EcoRII CCWGG 1 cut(s) 142
EcoT14I CCWWGG 1 cut(s) 216
ErhI CCWWGG 1 cut(s) 216
FaeI CATG 2 cut(s) 166, 202
FaiI YATR 4 cut(s) 93, 164, 200, 225
FatI CATG 2 cut(s) 162, 198
Hin1II CATG 2 cut(s) 166, 202
HinfI GANTC 2 cut(s) 159, 177
HphI GGTGA 2 cut(s) 24, 160
Hpy188I TCNGA 2 cut(s) 46, 176
Hpy188III TCNNGA 2 cut(s) 56, 163
HpyCH4III ACNGT 1 cut(s) 101
HpyCH4IV ACGT 1 cut(s) 41
HpyCH4V TGCA 2 cut(s) 23, 86
HpyF3I CTNAG 1 cut(s) 173
HpySE526I ACGT 1 cut(s) 41
Hsp92II CATG 2 cut(s) 166, 202
LpnPI CCDG 5 cut(s) 9, 48, 129, 156, 194
MaeII ACGT 1 cut(s) 41
MaeIII GTNAC 2 cut(s) 148, 191
MboII GAAGA 2 cut(s) 80, 178
MfeI CAATTG 1 cut(s) 114
MluCI AATT 1 cut(s) 114
MlyI GAGTC 1 cut(s) 168
MnlI CCTC 2 cut(s) 40, 182
MseI TTAA 1 cut(s) 6
MspR9I CCNGG 1 cut(s) 144
MunI CAATTG 1 cut(s) 114
MvaI CCWGG 1 cut(s) 144
NlaIII CATG 2 cut(s) 166, 202
NmuCI GTSAC 2 cut(s) 148, 191
PagI TCATGA 1 cut(s) 162
PfeI GAWTC 1 cut(s) 177
PleI GAGTC 1 cut(s) 167
PpsI GAGTC 1 cut(s) 167
PpuMI RGGWCCY 1 cut(s) 140
PsiI TTATAA 1 cut(s) 93
Psp5II RGGWCCY 1 cut(s) 140
Psp6I CCWGG 1 cut(s) 142
PspGI CCWGG 1 cut(s) 142
PspPI GGNCC 1 cut(s) 140
PspPPI RGGWCCY 1 cut(s) 140
PstI CTGCAG 1 cut(s) 25
PstNI CAGNNNCTG 1 cut(s) 180
SaqAI TTAA 1 cut(s) 6
Sau96I GGNCC 1 cut(s) 140
SchI GAGTC 1 cut(s) 168
ScrFI CCNGG 1 cut(s) 144
SetI ASST 7 cut(s) 37, 44, 51, 145, 174, 210, 222
SfcI CTRYAG 1 cut(s) 21
SinI GGWCC 1 cut(s) 140
Sse9I AATT 1 cut(s) 114
StyD4I CCNGG 1 cut(s) 142
StyI CCWWGG 1 cut(s) 216
TaaI ACNGT 1 cut(s) 101
TaiI ACGT 1 cut(s) 44
TasI AATT 1 cut(s) 114
TfiI GAWTC 1 cut(s) 177
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TscAI CASTG 1 cut(s) 106
TseFI GTSAC 2 cut(s) 148, 191
Tsp45I GTSAC 2 cut(s) 148, 191
TspDTI ATGAA 1 cut(s) 179
TspRI CASTG 1 cut(s) 106
VpaK11BI GGWCC 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.