Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001942.1

Orthogroup ID

OG0008887

Physical Location & Seq

Genomic Coordinates Reverse (-)

141075 .. 141718

Gene Structure 644 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001942.1_g000035.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 270 bp

atgttgcaagaaataaacagcagactcagagatgctggtcacattcctaatttggacaatgtcctgcttgatgttgatgagaaggagaaagagtacttgctcggtcgacatagtgagaaagtggccatagattttgggcttataggtatcgggaaaggactgccaattcgtgtgaaccatcaagcccttgagcctgaagctggaatgactgttgttcacctagtatgccaacagaatggatatccaccaaccataccccatccactttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0008150 GO:0008152 GO:0009451 GO:0009987 GO:0016070 GO:0016787 GO:0016788 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

89

Amino Acids

9.88

Weight (kDa)

5.63

Isoelectric Point (pI)

32.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008887)

Species	Orthologous Gene IDs
malus_domestica	MD00G1181600.v1.1
pyrus_communis	pycom14g16560
rosa_chinensis	RchiOBHm_Chr1g0328861 RchiOBHm_Chr1g0329111 RchiOBHm_Chr3g0457841 RchiOBHm_Chr4g0386501 RchiOBHm_Chr4g0388071 RchiOBHm_Chr4g0394521
rosa_laevigata	RLG00000010088 RLG00000023351 RLG00000023354
rosa_multiflora	Rmu_co7995176.1_g000001 Rmu_sc0001942.1_g000035 Rmu_sc0006648.1_g000002 Rmu_sc0008380.1_g000004 Rmu_sc0014755.1_g000005
rosa_roxburghii	Rroxscaffold_5G00333990 Rroxscaffold_5G00334610
rosa_rugosa	Rorug03G0307400 Rorug03G0307700 Rorug03G0364900.1
rosa_samantha	Rh4BG050700 Rh4DG010700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	106
AcoI	YGGCCR	1 cut(s)	123
AcuI	CTGAAG	1 cut(s)	216
AfaI	GTAC	1 cut(s)	95
AfiI	CCNNNNNNNGG	1 cut(s)	200
AluBI	AGCT	1 cut(s)	200
AluI	AGCT	1 cut(s)	200
AoxI	GGCC	1 cut(s)	123
ArsI	GACNNNNNNTTYG	2 cut(s)	150, 182
AsuHPI	GGTGA	1 cut(s)	209
BalI	TGGCCA	1 cut(s)	125
BccI	CCATC	2 cut(s)	186, 267
BfaI	CTAG	1 cut(s)	221
BmcAI	AGTACT	1 cut(s)	95
BmsI	GCATC	1 cut(s)	22
BpuEI	CTTGAG	1 cut(s)	209
BsaXI	ACNNNNNCTCC	2 cut(s)	77, 107
Bsc4I	CCNNNNNNNGG	1 cut(s)	200
BseGI	GGATG	1 cut(s)	259
BseLI	CCNNNNNNNGG	1 cut(s)	200
BseMII	CTCAG	1 cut(s)	40
Bsh1285I	CGRYCG	1 cut(s)	106
BshFI	GGCC	1 cut(s)	125
BsiEI	CGRYCG	1 cut(s)	106
BslI	CCNNNNNNNGG	1 cut(s)	200
BsnI	GGCC	1 cut(s)	125
BspANI	GGCC	1 cut(s)	125
BspCNI	CTCAG	1 cut(s)	39
Bst4CI	ACNGT	1 cut(s)	211
BstDEI	CTNAG	1 cut(s)	26
BstF5I	GGATG	1 cut(s)	259
BstMCI	CGRYCG	1 cut(s)	106
BstXI	CCANNNNNNTGG	1 cut(s)	236
BsuRI	GGCC	1 cut(s)	125
BtsCI	GGATG	1 cut(s)	259
Csp6I	GTAC	1 cut(s)	94
CviJI	RGCY	5 cut(s)	125, 139, 185, 193, 200
CviKI_1	RGCY	5 cut(s)	125, 139, 185, 193, 200
CviQI	GTAC	1 cut(s)	94
DdeI	CTNAG	1 cut(s)	26
EaeI	YGGCCR	1 cut(s)	123
Eco32I	GATATC	1 cut(s)	242
Eco57I	CTGAAG	1 cut(s)	216
EcoRV	GATATC	1 cut(s)	242
FaiI	YATR	5 cut(s)	111, 128, 143, 226, 254
FblI	GTMKAC	1 cut(s)	106
FokI	GGATG	1 cut(s)	246
FspBI	CTAG	1 cut(s)	221
HaeIII	GGCC	1 cut(s)	125
HincII	GTYRAC	1 cut(s)	107
HindII	GTYRAC	1 cut(s)	107
HinfI	GANTC	1 cut(s)	24
HphI	GGTGA	1 cut(s)	209
Hpy166II	GTNNAC	3 cut(s)	107, 175, 217
Hpy188I	TCNGA	1 cut(s)	29
Hpy188III	TCNNGA	1 cut(s)	151
Hpy8I	GTNNAC	3 cut(s)	107, 175, 217
HpyAV	CCTTC	1 cut(s)	76
HpyCH4III	ACNGT	1 cut(s)	211
HpyCH4V	TGCA	1 cut(s)	7
HpyF3I	CTNAG	1 cut(s)	26
LpnPI	CCDG	4 cut(s)	21, 77, 186, 207
LweI	GCATC	1 cut(s)	22
MaeI	CTAG	1 cut(s)	221
MaeIII	GTNAC	1 cut(s)	38
MlsI	TGGCCA	1 cut(s)	125
MluCI	AATT	2 cut(s)	49, 165
MluNI	TGGCCA	1 cut(s)	125
MlyI	GAGTC	1 cut(s)	18
Mox20I	TGGCCA	1 cut(s)	125
MscI	TGGCCA	1 cut(s)	125
Msp20I	TGGCCA	1 cut(s)	125
NmuCI	GTSAC	1 cut(s)	38
PflFI	GACNNNGTC	1 cut(s)	59
PleI	GAGTC	1 cut(s)	18
PpsI	GAGTC	1 cut(s)	18
PsyI	GACNNNGTC	1 cut(s)	59
RsaI	GTAC	1 cut(s)	95
RsaNI	GTAC	1 cut(s)	94
SalI	GTCGAC	1 cut(s)	105
ScaI	AGTACT	1 cut(s)	95
SchI	GAGTC	1 cut(s)	18
SetI	ASST	3 cut(s)	148, 202, 222
SfaNI	GCATC	1 cut(s)	22
SmlI	CTYRAG	1 cut(s)	188
SmoI	CTYRAG	1 cut(s)	188
Sse9I	AATT	2 cut(s)	49, 165
SspMI	CTAG	1 cut(s)	221
TaaI	ACNGT	1 cut(s)	211
TaqI	TCGA	1 cut(s)	106
TaqII	GACCGA	1 cut(s)	92
TasI	AATT	2 cut(s)	49, 165
TatI	WGTACW	1 cut(s)	93
TseFI	GTSAC	1 cut(s)	38
Tsp45I	GTSAC	1 cut(s)	38
Tth111I	GACNNNGTC	1 cut(s)	59
XmiI	GTMKAC	1 cut(s)	106
XspI	CTAG	1 cut(s)	221
ZrmI	AGTACT	1 cut(s)	95

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.