Rorug03G0307700

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
32682725 .. 32683012
288 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0307700.1

Sequence Viewer

Length: 288 bp
ATGTCTACCACAAAATCTCTGACTGCTACTAAGAAAGTGGTTATTCATCTGAGAGCTACTGGCGATGCCCCTATACTAAAGCAAGCCAAATTCAAGATACTTGTAACGGACAAGTTTGCTAAAGTGACTGACTTTTTAAGGAGGCAACTTCACCGAGATACGTTATTTGTGTATGTCAATAGTGCATTCTCACCAAACCCAGATGAATTGGTGATGGATCTGTATAATAATTTTGGTTTTGATGGTAAACTGGTAGTCAATTATGCTTGTTCCATTGCGTGGGGCTAA

Protein Analysis

95

Amino Acids

10.71

Weight (kDa)

9.56

Isoelectric Point (pI)

32.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
APG12 PF04110 12 - 95 5.2e-33 Ubiquitin-like autophagy protein Apg12
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 279
AccI GTMKAC 1 cut(s) 5
AclWI GGATC 1 cut(s) 225
AcsI RAATTY 1 cut(s) 89
AfiI CCNNNNNNNGG 1 cut(s) 279
AgsI TTSAA 1 cut(s) 94
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
AlwI GGATC 1 cut(s) 225
ApoI RAATTY 1 cut(s) 89
AsuHPI GGTGA 3 cut(s) 143, 183, 223
BccI CCATC 2 cut(s) 208, 236
BmsI GCATC 1 cut(s) 55
Bsc4I CCNNNNNNNGG 1 cut(s) 279
Bse1I ACTGG 2 cut(s) 64, 255
Bse3DI GCAATG 1 cut(s) 273
BseLI CCNNNNNNNGG 1 cut(s) 279
BseMI GCAATG 1 cut(s) 273
BseMII CTCAG 1 cut(s) 41
BseNI ACTGG 2 cut(s) 64, 255
BslI CCNNNNNNNGG 1 cut(s) 279
BsmI GAATGC 1 cut(s) 185
Bsp143I GATC 1 cut(s) 217
BspCNI CTCAG 1 cut(s) 42
BspPI GGATC 1 cut(s) 225
BsrDI GCAATG 1 cut(s) 273
BsrI ACTGG 2 cut(s) 64, 255
BssMI GATC 1 cut(s) 217
BstC8I GCNNGC 1 cut(s) 84
BstDEI CTNAG 2 cut(s) 30, 50
BstKTI GATC 1 cut(s) 220
BstMBI GATC 1 cut(s) 217
BstX2I RGATCY 1 cut(s) 217
BstYI RGATCY 1 cut(s) 217
BtgZI GCGATG 1 cut(s) 78
Cac8I GCNNGC 1 cut(s) 84
CviJI RGCY 3 cut(s) 56, 86, 285
CviKI_1 RGCY 3 cut(s) 56, 86, 285
DdeI CTNAG 2 cut(s) 30, 50
DpnI GATC 1 cut(s) 219
DpnII GATC 1 cut(s) 217
FaiI YATR 4 cut(s) 74, 174, 225, 264
FblI GTMKAC 1 cut(s) 5
HphI GGTGA 3 cut(s) 143, 183, 223
Hpy166II GTNNAC 2 cut(s) 6, 248
Hpy188I TCNGA 2 cut(s) 21, 51
Hpy188III TCNNGA 1 cut(s) 94
Hpy8I GTNNAC 2 cut(s) 6, 248
HpyCH4IV ACGT 1 cut(s) 161
HpyCH4V TGCA 1 cut(s) 185
HpyF3I CTNAG 2 cut(s) 30, 50
HpySE526I ACGT 1 cut(s) 161
Kzo9I GATC 1 cut(s) 217
LpnPI CCDG 3 cut(s) 45, 213, 236
LweI GCATC 1 cut(s) 55
MaeII ACGT 1 cut(s) 161
MaeIII GTNAC 2 cut(s) 103, 124
MalI GATC 1 cut(s) 219
MboI GATC 1 cut(s) 217
MflI RGATCY 1 cut(s) 217
MluCI AATT 4 cut(s) 89, 206, 229, 259
MnlI CCTC 1 cut(s) 135
MseI TTAA 1 cut(s) 137
Mva1269I GAATGC 1 cut(s) 185
NdeII GATC 1 cut(s) 217
NmuCI GTSAC 1 cut(s) 124
PctI GAATGC 1 cut(s) 185
PflMI CCANNNNNTGG 1 cut(s) 279
PsuI RGATCY 1 cut(s) 217
SaqAI TTAA 1 cut(s) 137
Sau3AI GATC 1 cut(s) 217
SetI ASST 2 cut(s) 58, 164
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 9 cut(s) 72, 95, 106, 113, 124, 167, 212, 263, 279
Sse9I AATT 4 cut(s) 89, 206, 229, 259
TaiI ACGT 1 cut(s) 164
TasI AATT 4 cut(s) 89, 206, 229, 259
Tru1I TTAA 1 cut(s) 137
Tru9I TTAA 1 cut(s) 137
TseFI GTSAC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 124
TspDTI ATGAA 2 cut(s) 35, 219
TspGWI ACGGA 1 cut(s) 122
Van91I CCANNNNNTGG 1 cut(s) 279
XapI RAATTY 1 cut(s) 89
XmiI GTMKAC 1 cut(s) 5
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.