Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8167496.1

Orthogroup ID

OG0003376

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 669

Gene Structure 669 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8167496.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 669 bp

ttattgccttccgtggcaccttaaccgcgtatgacctggtctcgcgagatcttaacttgtccctcaagttaatcaaaaatggacttcacaagacatctcgctttaagactgctatgcaagcaatccaagctacggttggggaagcaggtgattcatcaagcgtttggctagctggccattccatgggttcagtattggcaatgcttgctggaaaaacaatggccaaggacggaatcttactcaaatcttttctcttcaatcaaccatttgttttcgttgccccgatggagaggatcaaacacgagaatatcaagcttggtattcgctttgcccggagtgtgttcactgcgggactggctaaagctgtaaatcccacctggtcagaacgcgaagatccattcttcggtctttatgaatgggttcctagtgtatttgtgaatcaaggtgatgacttctgctctggatatattggttatttcgaacatagaaagaagatggtagagattggagcaggaggcattgagcggttggcaacccagaattcaattgggagtttattgaggtatgcaataggaaaggagacagagccaccaatgcacctcattcctagtgcaaacctcacggtcaatttaaccccttcaaggaatttcaaagaagcccatggaattc

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Lipase_3

Protein Analysis

222

Amino Acids

24.44

Weight (kDa)

9.46

Isoelectric Point (pI)

27.9

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003376)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G05260 AT2G05260 AT4G10955 AT4G10955
fragaria_vesca	FvH4_5g04751 FvH4_5g04751 FvH4_5g04760
malus_domestica	MD06G1108800.v1.1 MD14G1129700.v1.1
prunus_persica	Prupe.5G121400_v2.0.a1 Prupe.5G121400_v2.0.a1 Prupe.5G121600_v2.0.a1
pyrus_communis	pycom06g10220
rosa_chinensis	RchiOBHm_Chr7g0194501 RchiOBHm_Chr7g0194511
rosa_laevigata	RLG00000004195 RLG00000004196 RLG00000023363 RLG00000023364
rosa_multiflora	Rmu_co8167496.1_g000001 Rmu_co8479523.1_g000001 Rmu_sc0041088.1_g000001 Rmu_ssc0000261.1_g000021
rosa_roxburghii	Rroxscaffold_3G00261290 Rroxscaffold_3G00261300
rosa_rugosa	Rorug07G0016000
rosa_samantha	Rh7AG143400 Rh7AG143500 Rh7BG143900 Rh7BG144000 Rh7CG147600 Rh7CG147700 Rh7DG145200 Rh7DG145300
rosa_wichuraiana	Rw7G012280 Rw7G012290

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	136
Acc36I	ACCTGC	1 cut(s)	136
AccB1I	GGYRCC	1 cut(s)	16
AccB7I	CCANNNNNTGG	1 cut(s)	183
AccBSI	CCGCTC	1 cut(s)	525
AccII	CGCG	3 cut(s)	28, 45, 389
AciI	CCGC	3 cut(s)	26, 349, 525
AclWI	GGATC	2 cut(s)	301, 388
AcoI	YGGCCR	2 cut(s)	174, 221
AcsI	RAATTY	3 cut(s)	540, 645, 665
AfiI	CCNNNNNNNGG	4 cut(s)	132, 183, 403, 641
AgsI	TTSAA	4 cut(s)	258, 545, 641, 651
AjnI	CCWGG	2 cut(s)	35, 376
AluBI	AGCT	4 cut(s)	130, 172, 315, 364
AluI	AGCT	4 cut(s)	130, 172, 315, 364
Alw26I	GTCTC	2 cut(s)	45, 574
AlwI	GGATC	2 cut(s)	301, 388
AoxI	GGCC	2 cut(s)	174, 221
ApoI	RAATTY	3 cut(s)	540, 645, 665
Asp700I	GAANNNNTTC	1 cut(s)	419
AsuC2I	CCSGG	1 cut(s)	333
AsuHPI	GGTGA	2 cut(s)	160, 457
AsuII	TTCGAA	1 cut(s)	479
AsuNHI	GCTAGC	1 cut(s)	168
BalI	TGGCCA	2 cut(s)	176, 223
BanI	GGYRCC	1 cut(s)	16
BauI	CACGAG	1 cut(s)	301
BccI	CCATC	2 cut(s)	279, 489
BciT130I	CCWGG	2 cut(s)	37, 378
BcnI	CCSGG	1 cut(s)	333
BcoDI	GTCTC	2 cut(s)	45, 574
BfaI	CTAG	3 cut(s)	169, 425, 608
BfuAI	ACCTGC	1 cut(s)	136
BglII	AGATCT	1 cut(s)	48
Bme1390I	CCNGG	3 cut(s)	37, 333, 378
BmiI	GGNNCC	2 cut(s)	18, 422
BmrFI	CCNGG	3 cut(s)	37, 333, 378
BmtI	GCTAGC	1 cut(s)	172
Bpu14I	TTCGAA	1 cut(s)	479
BpuEI	CTTGAG	1 cut(s)	49
BpuMI	CCSGG	1 cut(s)	333
BsaI	GGTCTC	1 cut(s)	45
BsaJI	CCNNGG	4 cut(s)	12, 182, 224, 660
Bsc4I	CCNNNNNNNGG	4 cut(s)	132, 183, 403, 641
Bse1I	ACTGG	1 cut(s)	359
Bse3DI	GCAATG	1 cut(s)	206
BseBI	CCWGG	2 cut(s)	37, 378
BseDI	CCNNGG	4 cut(s)	12, 182, 224, 660
BseLI	CCNNNNNNNGG	4 cut(s)	132, 183, 403, 641
BseMI	GCAATG	1 cut(s)	206
BseNI	ACTGG	1 cut(s)	359
Bsh1236I	CGCG	3 cut(s)	28, 45, 389
BshFI	GGCC	2 cut(s)	176, 223
BshNI	GGYRCC	1 cut(s)	16
BsiSI	CCGG	1 cut(s)	333
BslFI	GGGAC	2 cut(s)	45, 365
BslI	CCNNNNNNNGG	4 cut(s)	132, 183, 403, 641
BsmAI	GTCTC	2 cut(s)	45, 574
BsmFI	GGGAC	2 cut(s)	45, 365
BsnI	GGCC	2 cut(s)	176, 223
Bso31I	GGTCTC	1 cut(s)	45
Bsp119I	TTCGAA	1 cut(s)	479
Bsp143I	GATC	3 cut(s)	48, 293, 393
Bsp19I	CCATGG	2 cut(s)	182, 660
Bsp68I	TCGCGA	1 cut(s)	45
BspACI	CCGC	3 cut(s)	26, 349, 525
BspANI	GGCC	2 cut(s)	176, 223
BspFNI	CGCG	3 cut(s)	28, 45, 389
BspLI	GGNNCC	2 cut(s)	18, 422
BspMI	ACCTGC	1 cut(s)	136
BspOI	GCTAGC	1 cut(s)	172
BspPI	GGATC	2 cut(s)	301, 388
BspT104I	TTCGAA	1 cut(s)	479
BspT107I	GGYRCC	1 cut(s)	16
BspTNI	GGTCTC	1 cut(s)	45
BsrBI	CCGCTC	1 cut(s)	525
BsrDI	GCAATG	1 cut(s)	206
BsrI	ACTGG	1 cut(s)	359
BssECI	CCNNGG	4 cut(s)	12, 182, 224, 660
BssMI	GATC	3 cut(s)	48, 293, 393
BssSI	CACGAG	1 cut(s)	301
BssT1I	CCWWGG	3 cut(s)	182, 224, 660
Bst2BI	CACGAG	1 cut(s)	301
Bst2UI	CCWGG	2 cut(s)	37, 378
Bst4CI	ACNGT	2 cut(s)	135, 624
Bst6I	CTCTTC	1 cut(s)	259
BstAPI	GCANNNNNTGC	1 cut(s)	205
BstBI	TTCGAA	1 cut(s)	479
BstC8I	GCNNGC	4 cut(s)	119, 170, 174, 206
BstDSI	CCRYGG	3 cut(s)	12, 182, 660
BstFNI	CGCG	3 cut(s)	28, 45, 389
BstKTI	GATC	3 cut(s)	51, 296, 396
BstMAI	GTCTC	2 cut(s)	45, 574
BstMBI	GATC	3 cut(s)	48, 293, 393
BstMWI	GCNNNNNNNGC	5 cut(s)	118, 127, 205, 355, 594
BstNI	CCWGG	2 cut(s)	37, 378
BstSCI	CCNGG	3 cut(s)	35, 331, 376
BstUI	CGCG	3 cut(s)	28, 45, 389
BstX2I	RGATCY	2 cut(s)	48, 393
BstYI	RGATCY	2 cut(s)	48, 393
BsuRI	GGCC	2 cut(s)	176, 223
BtgI	CCRYGG	3 cut(s)	12, 182, 660
BtsI	GCAGTG	1 cut(s)	344
BtsIMutI	CAGTG	1 cut(s)	344
BtuMI	TCGCGA	1 cut(s)	45
BveI	ACCTGC	1 cut(s)	136
Cac8I	GCNNGC	4 cut(s)	119, 170, 174, 206
CsiI	ACCWGGT	2 cut(s)	35, 376
CviAII	CATG	2 cut(s)	183, 661
DpnI	GATC	3 cut(s)	50, 295, 395
DpnII	GATC	3 cut(s)	48, 293, 393
EaeI	YGGCCR	2 cut(s)	174, 221
Eam1104I	CTCTTC	1 cut(s)	259
EarI	CTCTTC	1 cut(s)	259
Eco130I	CCWWGG	3 cut(s)	182, 224, 660
Eco31I	GGTCTC	1 cut(s)	45
EcoRI	GAATTC	2 cut(s)	540, 665
EcoRII	CCWGG	2 cut(s)	35, 376
EcoT14I	CCWWGG	3 cut(s)	182, 224, 660
ErhI	CCWWGG	3 cut(s)	182, 224, 660
FaeI	CATG	2 cut(s)	186, 664
FaiI	YATR	8 cut(s)	32, 115, 184, 413, 467, 485, 566, 662
FaqI	GGGAC	2 cut(s)	45, 365
FatI	CATG	2 cut(s)	182, 660
FauI	CCCGC	1 cut(s)	342
FspBI	CTAG	3 cut(s)	169, 425, 608
HaeIII	GGCC	2 cut(s)	176, 223
HapII	CCGG	1 cut(s)	333
Hin1II	CATG	2 cut(s)	186, 664
HindIII	AAGCTT	1 cut(s)	313
HinfI	GANTC	3 cut(s)	151, 233, 438
HpaII	CCGG	1 cut(s)	333
HphI	GGTGA	2 cut(s)	160, 457
Hpy166II	GTNNAC	1 cut(s)	344
Hpy188I	TCNGA	1 cut(s)	384
Hpy188III	TCNNGA	2 cut(s)	44, 461
Hpy8I	GTNNAC	1 cut(s)	344
HpyAV	CCTTC	2 cut(s)	18, 647
HpyCH4III	ACNGT	2 cut(s)	135, 624
HpyCH4V	TGCA	4 cut(s)	117, 568, 597, 613
HpyF10VI	GCNNNNNNNGC	5 cut(s)	118, 127, 205, 355, 594
Hsp92II	CATG	2 cut(s)	186, 664
Kzo9I	GATC	3 cut(s)	48, 293, 393
LmnI	GCTCC	1 cut(s)	508
MabI	ACCWGGT	2 cut(s)	35, 376
MaeI	CTAG	3 cut(s)	169, 425, 608
MalI	GATC	3 cut(s)	50, 295, 395
MbiI	CCGCTC	1 cut(s)	525
MboI	GATC	3 cut(s)	48, 293, 393
MboII	GAAGA	4 cut(s)	246, 393, 403, 504
MfeI	CAATTG	1 cut(s)	545
MflI	RGATCY	2 cut(s)	48, 393
MlsI	TGGCCA	2 cut(s)	176, 223
MluCI	AATT	5 cut(s)	540, 545, 627, 645, 665
MluNI	TGGCCA	2 cut(s)	176, 223
MnlI	CCTC	6 cut(s)	73, 284, 508, 554, 610, 628
Mox20I	TGGCCA	2 cut(s)	176, 223
MroXI	GAANNNNTTC	1 cut(s)	419
MscI	TGGCCA	2 cut(s)	176, 223
MseI	TTAA	5 cut(s)	22, 53, 70, 104, 631
Msp20I	TGGCCA	2 cut(s)	176, 223
MspI	CCGG	1 cut(s)	333
MspR9I	CCNGG	3 cut(s)	37, 333, 378
MunI	CAATTG	1 cut(s)	545
MvaI	CCWGG	2 cut(s)	37, 378
MvnI	CGCG	3 cut(s)	28, 45, 389
MwoI	GCNNNNNNNGC	5 cut(s)	118, 127, 205, 355, 594
NciI	CCSGG	1 cut(s)	333
NcoI	CCATGG	2 cut(s)	182, 660
NdeII	GATC	3 cut(s)	48, 293, 393
NheI	GCTAGC	1 cut(s)	168
NlaIII	CATG	2 cut(s)	186, 664
NlaIV	GGNNCC	2 cut(s)	18, 422
NruI	TCGCGA	1 cut(s)	45
NspV	TTCGAA	1 cut(s)	479
PaqCI	CACCTGC	1 cut(s)	136
PdmI	GAANNNNTTC	1 cut(s)	419
PfeI	GAWTC	3 cut(s)	151, 233, 438
PflFI	GACNNNGTC	1 cut(s)	37
PflMI	CCANNNNNTGG	1 cut(s)	183
Psp6I	CCWGG	2 cut(s)	35, 376
PspGI	CCWGG	2 cut(s)	35, 376
PspN4I	GGNNCC	2 cut(s)	18, 422
PsuI	RGATCY	2 cut(s)	48, 393
PsyI	GACNNNGTC	1 cut(s)	37
RruI	TCGCGA	1 cut(s)	45
SaqAI	TTAA	5 cut(s)	22, 53, 70, 104, 631
Sau3AI	GATC	3 cut(s)	48, 293, 393
ScrFI	CCNGG	3 cut(s)	37, 333, 378
SexAI	ACCWGGT	2 cut(s)	35, 376
SfuI	TTCGAA	1 cut(s)	479
SmlI	CTYRAG	1 cut(s)	64
SmoI	CTYRAG	1 cut(s)	64
Sse9I	AATT	5 cut(s)	540, 545, 627, 645, 665
SsiI	CCGC	3 cut(s)	26, 349, 525
SspMI	CTAG	3 cut(s)	169, 425, 608
StyD4I	CCNGG	3 cut(s)	35, 331, 376
StyI	CCWWGG	3 cut(s)	182, 224, 660
TaaI	ACNGT	2 cut(s)	135, 624
TaqI	TCGA	1 cut(s)	479
TaqII	GACCGA	1 cut(s)	394
TasI	AATT	5 cut(s)	540, 545, 627, 645, 665
TfiI	GAWTC	3 cut(s)	151, 233, 438
Tru1I	TTAA	5 cut(s)	22, 53, 70, 104, 631
Tru9I	TTAA	5 cut(s)	22, 53, 70, 104, 631
TscAI	CASTG	1 cut(s)	351
TspDTI	ATGAA	2 cut(s)	143, 428
TspGWI	ACGGA	1 cut(s)	245
TspRI	CASTG	1 cut(s)	351
Tth111I	GACNNNGTC	1 cut(s)	37
Van91I	CCANNNNNTGG	1 cut(s)	183
XapI	RAATTY	3 cut(s)	540, 645, 665
XcmI	CCANNNNNNNNNTGG	2 cut(s)	133, 544
XmnI	GAANNNNTTC	1 cut(s)	419
XspI	CTAG	3 cut(s)	169, 425, 608

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.