Rmu_co8191116.1_g000001

ATP-citrate synthase alpha chain protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8191116.1
Physical Location & Seq
Forward (+)
1 .. 642
642 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8191116.1_g000001.1.cds

Sequence Viewer

Length: 306 bp
tgtgcaacttctgatcctgatggccgtaagagagcccttgtaattggagggggaattgctaacttcactgatgtagctgcaacattcaatggcattattagagccttgaaggagaaggaatcaaagcttaaagctgctaggatgcatctttatgtcaggagaggaggtcccaactaccagaggggacttgcaaaaatgagggcacttgcagaggaaattggcctccctattgaggtctatggtcctgaagcaacaatgactggtatttgcaagcaggcaattcagtgcatcagtgctgctgcatga

Protein Analysis

101

Amino Acids

10.76

Weight (kDa)

9.55

Isoelectric Point (pI)

35.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 8
AcoI YGGCCR 1 cut(s) 22
AcuI CTGAAG 1 cut(s) 267
AfiI CCNNNNNNNGG 1 cut(s) 232
AgsI TTSAA 2 cut(s) 88, 109
AluBI AGCT 3 cut(s) 77, 127, 134
AluI AGCT 3 cut(s) 77, 127, 134
AlwI GGATC 1 cut(s) 8
AoxI GGCC 2 cut(s) 22, 220
ApeKI GCWGC 4 cut(s) 77, 134, 296, 299
AspS9I GGNCC 2 cut(s) 167, 242
AvaII GGWCC 2 cut(s) 167, 242
BaeGI GKGCMC 1 cut(s) 205
BanII GRGCYC 1 cut(s) 37
BbvI GCAGC 4 cut(s) 64, 121, 283, 286
BccI CCATC 1 cut(s) 14
BceAI ACGGC 1 cut(s) 9
BfaI CTAG 1 cut(s) 138
BisI GCNGC 4 cut(s) 78, 135, 297, 300
BlsI GCNGC 4 cut(s) 79, 136, 298, 301
Bme18I GGWCC 2 cut(s) 167, 242
BmgT120I GGNCC 2 cut(s) 167, 242
BmiI GGNNCC 1 cut(s) 169
BmsI GCATC 3 cut(s) 132, 154, 297
BsaXI ACNNNNNCTCC 2 cut(s) 151, 181
Bsc4I CCNNNNNNNGG 1 cut(s) 232
Bse1I ACTGG 1 cut(s) 265
BseGI GGATG 1 cut(s) 147
BseLI CCNNNNNNNGG 1 cut(s) 232
BseNI ACTGG 1 cut(s) 265
BseRI GAGGAG 1 cut(s) 177
BseSI GKGCMC 1 cut(s) 205
BseXI GCAGC 4 cut(s) 64, 121, 283, 286
BshFI GGCC 2 cut(s) 24, 222
BslFI GGGAC 2 cut(s) 153, 198
BslI CCNNNNNNNGG 1 cut(s) 232
BsmFI GGGAC 2 cut(s) 153, 198
BsnI GGCC 2 cut(s) 24, 222
Bsp1286I GDGCHC 2 cut(s) 37, 205
Bsp143I GATC 1 cut(s) 13
BspANI GGCC 2 cut(s) 24, 222
BspLI GGNNCC 1 cut(s) 169
BspPI GGATC 1 cut(s) 8
BsrI ACTGG 1 cut(s) 265
BssMI GATC 1 cut(s) 13
BstC8I GCNNGC 2 cut(s) 272, 276
BstF5I GGATG 1 cut(s) 147
BstKTI GATC 1 cut(s) 16
BstMBI GATC 1 cut(s) 13
BstSLI GKGCMC 1 cut(s) 205
BstV1I GCAGC 4 cut(s) 64, 121, 283, 286
BsuRI GGCC 2 cut(s) 24, 222
BtsCI GGATG 1 cut(s) 147
BtsIMutI CAGTG 3 cut(s) 66, 290, 298
Cac8I GCNNGC 2 cut(s) 272, 276
Cfr13I GGNCC 2 cut(s) 167, 242
CviAII CATG 1 cut(s) 303
CviJI RGCY 7 cut(s) 24, 35, 77, 104, 127, 134, 222
CviKI_1 RGCY 7 cut(s) 24, 35, 77, 104, 127, 134, 222
DpnI GATC 1 cut(s) 15
DpnII GATC 1 cut(s) 13
EaeI YGGCCR 1 cut(s) 22
Eco24I GRGCYC 1 cut(s) 37
Eco47I GGWCC 2 cut(s) 167, 242
Eco57I CTGAAG 1 cut(s) 267
EcoO109I RGGNCCY 1 cut(s) 167
EcoT22I ATGCAT 1 cut(s) 147
EcoT38I GRGCYC 1 cut(s) 37
FaeI CATG 1 cut(s) 306
FaiI YATR 3 cut(s) 153, 240, 304
FaqI GGGAC 2 cut(s) 153, 198
FatI CATG 1 cut(s) 302
Fnu4HI GCNGC 4 cut(s) 78, 135, 297, 300
FokI GGATG 1 cut(s) 154
FriOI GRGCYC 1 cut(s) 37
Fsp4HI GCNGC 4 cut(s) 78, 135, 297, 300
FspBI CTAG 1 cut(s) 138
GluI GCNGC 4 cut(s) 78, 135, 297, 300
HaeIII GGCC 2 cut(s) 24, 222
Hin1II CATG 1 cut(s) 306
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 1 cut(s) 119
Hpy188I TCNGA 1 cut(s) 13
Hpy188III TCNNGA 3 cut(s) 17, 157, 245
HpyAV CCTTC 2 cut(s) 103, 109
HpyCH4V TGCA 8 cut(s) 5, 80, 145, 191, 209, 270, 288, 302
Hsp92II CATG 1 cut(s) 306
Kzo9I GATC 1 cut(s) 13
LpnPI CCDG 6 cut(s) 30, 142, 191, 246, 258, 260
Lsp1109I GCAGC 4 cut(s) 64, 121, 283, 286
LweI GCATC 3 cut(s) 132, 154, 297
MaeI CTAG 1 cut(s) 138
MalI GATC 1 cut(s) 15
MboI GATC 1 cut(s) 13
MhlI GDGCHC 2 cut(s) 37, 205
MluCI AATT 4 cut(s) 42, 54, 216, 279
MnlI CCTC 8 cut(s) 41, 155, 158, 174, 192, 205, 226, 233
Mph1103I ATGCAT 1 cut(s) 147
MseI TTAA 1 cut(s) 129
MslI CAYNNNNRTG 1 cut(s) 150
NdeII GATC 1 cut(s) 13
NlaIII CATG 1 cut(s) 306
NlaIV GGNNCC 1 cut(s) 169
NsiI ATGCAT 1 cut(s) 147
PfeI GAWTC 1 cut(s) 119
PkrI GCNGC 4 cut(s) 79, 136, 298, 301
PpuMI RGGWCCY 1 cut(s) 167
Psp5II RGGWCCY 1 cut(s) 167
PspN4I GGNNCC 1 cut(s) 169
PspPI GGNCC 2 cut(s) 167, 242
PspPPI RGGWCCY 1 cut(s) 167
RseI CAYNNNNRTG 1 cut(s) 150
SaqAI TTAA 1 cut(s) 129
SatI GCNGC 4 cut(s) 78, 135, 297, 300
Sau3AI GATC 1 cut(s) 13
Sau96I GGNCC 2 cut(s) 167, 242
SduI GDGCHC 2 cut(s) 37, 205
SetI ASST 5 cut(s) 79, 129, 136, 169, 237
SfaNI GCATC 3 cut(s) 132, 154, 297
SinI GGWCC 2 cut(s) 167, 242
SmiMI CAYNNNNRTG 1 cut(s) 150
Sse9I AATT 4 cut(s) 42, 54, 216, 279
SspMI CTAG 1 cut(s) 138
TasI AATT 4 cut(s) 42, 54, 216, 279
TfiI GAWTC 1 cut(s) 119
Tru1I TTAA 1 cut(s) 129
Tru9I TTAA 1 cut(s) 129
TscAI CASTG 3 cut(s) 73, 290, 298
TseI GCWGC 4 cut(s) 77, 134, 296, 299
TspRI CASTG 3 cut(s) 73, 290, 298
VpaK11BI GGWCC 2 cut(s) 167, 242
XspI CTAG 1 cut(s) 138
Zsp2I ATGCAT 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.