Rmu_co8203290.1_g000001

Uncharacterized protein family, UPF0114

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8203290.1
Physical Location & Seq
Reverse (-)
2 .. 702
701 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8203290.1_g000001.1.cds

Sequence Viewer

Length: 196 bp
atgttaatatttggtatgggattgtatggattatttatcagtaatgtgcctaatgatgtgccttccaatgctgatcgtgctttgaagggatcttctttgtttggaatgtttgctttgaaggagaggcctaaatggatgaaaattagctcacttgatgaattgaagacgaaagtggggcatgttattgtcatgattc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

65

Amino Acids

7.21

Weight (kDa)

9.6

Isoelectric Point (pI)

17.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 97
AgsI TTSAA 3 cut(s) 85, 118, 163
AluBI AGCT 1 cut(s) 147
AluI AGCT 1 cut(s) 147
AlwI GGATC 1 cut(s) 97
AoxI GGCC 1 cut(s) 125
BbsI GAAGAC 1 cut(s) 170
BpiI GAAGAC 1 cut(s) 170
BseGI GGATG 1 cut(s) 141
BshFI GGCC 1 cut(s) 127
BsnI GGCC 1 cut(s) 127
Bsp143I GATC 2 cut(s) 73, 89
BspANI GGCC 1 cut(s) 127
BspHI TCATGA 1 cut(s) 189
BspPI GGATC 1 cut(s) 97
BssMI GATC 2 cut(s) 73, 89
BstF5I GGATG 1 cut(s) 141
BstKTI GATC 2 cut(s) 76, 92
BstMBI GATC 2 cut(s) 73, 89
BstMWI GCNNNNNNNGC 1 cut(s) 77
BstNSI RCATGY 1 cut(s) 182
BstV2I GAAGAC 1 cut(s) 170
BstX2I RGATCY 1 cut(s) 89
BstYI RGATCY 1 cut(s) 89
BsuRI GGCC 1 cut(s) 127
BtsCI GGATG 1 cut(s) 141
CciI TCATGA 1 cut(s) 189
CviAII CATG 2 cut(s) 179, 190
CviJI RGCY 2 cut(s) 127, 147
CviKI_1 RGCY 2 cut(s) 127, 147
DpnI GATC 2 cut(s) 75, 91
DpnII GATC 2 cut(s) 73, 89
Eco147I AGGCCT 1 cut(s) 127
FaeI CATG 2 cut(s) 182, 193
FaiI YATR 4 cut(s) 17, 27, 180, 191
FatI CATG 2 cut(s) 178, 189
FokI GGATG 1 cut(s) 148
HaeIII GGCC 1 cut(s) 127
Hin1II CATG 2 cut(s) 182, 193
HinfI GANTC 1 cut(s) 193
Hpy188III TCNNGA 1 cut(s) 190
HpyAV CCTTC 3 cut(s) 72, 79, 112
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
Hsp92II CATG 2 cut(s) 182, 193
Kzo9I GATC 2 cut(s) 73, 89
MalI GATC 2 cut(s) 75, 91
MboI GATC 2 cut(s) 73, 89
MboII GAAGA 2 cut(s) 84, 175
MflI RGATCY 1 cut(s) 89
MluCI AATT 2 cut(s) 141, 158
MnlI CCTC 1 cut(s) 117
MseI TTAA 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 77
NdeII GATC 2 cut(s) 73, 89
NlaIII CATG 2 cut(s) 182, 193
NspI RCATGY 1 cut(s) 182
PagI TCATGA 1 cut(s) 189
PceI AGGCCT 1 cut(s) 127
PfeI GAWTC 1 cut(s) 193
PsuI RGATCY 1 cut(s) 89
SaqAI TTAA 1 cut(s) 5
Sau3AI GATC 2 cut(s) 73, 89
SetI ASST 1 cut(s) 149
SgeI CNNG 3 cut(s) 89, 164, 191
Sse9I AATT 2 cut(s) 141, 158
SseBI AGGCCT 1 cut(s) 127
SspI AATATT 1 cut(s) 9
StuI AGGCCT 1 cut(s) 127
TasI AATT 2 cut(s) 141, 158
TfiI GAWTC 1 cut(s) 193
Tru1I TTAA 1 cut(s) 5
Tru9I TTAA 1 cut(s) 5
TspDTI ATGAA 2 cut(s) 152, 171
XceI RCATGY 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.