Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8205018.1

Orthogroup ID

OG0003108

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 527

Gene Structure 527 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8205018.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 264 bp

gatatcaagagggttttgagaagatttgggagcaacatcatcttctttaatggcttaagagacccttggagtggtggaggggtgctgaacaatatttccaagaggatagtagcaattgttgcaaaagaaggtgctcaccatgttgacttgaggttcaaaactagagaagatccagaatggcttaacgatgtgaggaagcaagagatcaagatcattggaaagtggatctcagaatattatcatgaccttgctgataaacattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001525 GO:0001568 GO:0001944 GO:0003008 GO:0003013 GO:0003073 GO:0003085 GO:0003674 GO:0003824 GO:0004177 GO:0006508 GO:0006807 GO:0006950 GO:0007275 GO:0008015 GO:0008150 GO:0008152 GO:0008217 GO:0008233 GO:0008238 GO:0008239 GO:0009611 GO:0009653 GO:0010594 GO:0010632 GO:0016787 GO:0019538 GO:0030334 GO:0032501 GO:0032502 GO:0032879 GO:0035239 GO:0035295 GO:0040012 GO:0042060 GO:0043170 GO:0043535 GO:0044238 GO:0045776 GO:0048514 GO:0048646 GO:0048731 GO:0048856 GO:0050789 GO:0050794 GO:0050896 GO:0051239 GO:0051270 GO:0060055 GO:0065007 GO:0065008 GO:0070011 GO:0071704 GO:0072358 GO:0072359 GO:0140096 GO:1901564 GO:2000145

KEGG Pathways

Metabolic & Signaling

ko04614 ko04974 map04614 map04974

Pfam Domains

Protein Families

Peptidase_S28

Protein Analysis

87

Amino Acids

10.2

Weight (kDa)

9.63

Isoelectric Point (pI)

44.37

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003108)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G24280 AT2G24280
fragaria_vesca	FvH4_3g30240 FvH4_6g19570 FvH4_6g19580 FvH4_6g48670 FvH4_6g48670 FvH4_6g48670 FvH4_6g48670 FvH4_6g48670
malus_domestica	MD12G1032200.v1.1
prunus_persica	Prupe.7G100400_v2.0.a1 Prupe.7G100500_v2.0.a1
pyrus_communis	pycom11g12430 pycom12g02980
rosa_chinensis	RchiOBHm_Chr3g0474931 RchiOBHm_Chr3g0474941
rosa_laevigata	RLG00000023876 RLG00000023878
rosa_multiflora	Rmu_co8205018.1_g000001 Rmu_sc0003093.1_g000003 Rmu_sc0003093.1_g000004 Rmu_sc0014618.1_g000001
rosa_roxburghii	Rroxscaffold_6G00406680 Rroxscaffold_6G00406700 Rroxscaffold_6G00406710 Rroxscaffold_7G00214050
rosa_rugosa	Rorug03G0145600
rosa_samantha	Rh3AG195100 Rh3BG225100 Rh3BG225200 Rh3CG220000 Rh3CG220100 Rh3DG220500 Rh3DG220600
rosa_wichuraiana	Rw3G017750 Rw3G017760

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	2 cut(s)	164, 233
AfiI	CCNNNNNNNGG	1 cut(s)	71
AflII	CTTAAG	1 cut(s)	55
AgsI	TTSAA	1 cut(s)	157
AloI	GAACNNNNNNTCC	2 cut(s)	80, 112
Alw21I	GWGCWC	1 cut(s)	136
Alw26I	GTCTC	1 cut(s)	54
AlwI	GGATC	2 cut(s)	164, 233
AsuHPI	GGTGA	1 cut(s)	128
Bbv12I	GWGCWC	1 cut(s)	136
BcoDI	GTCTC	1 cut(s)	54
BfaI	CTAG	1 cut(s)	162
BfrI	CTTAAG	1 cut(s)	55
BpuEI	CTTGAG	1 cut(s)	169
BsaBI	GATNNNNATC	1 cut(s)	209
BsaI	GGTCTC	1 cut(s)	54
BsaJI	CCNNGG	1 cut(s)	65
Bsc4I	CCNNNNNNNGG	1 cut(s)	71
Bse8I	GATNNNNATC	1 cut(s)	209
BseDI	CCNNGG	1 cut(s)	65
BseJI	GATNNNNATC	1 cut(s)	209
BseLI	CCNNNNNNNGG	1 cut(s)	71
BseMII	CTCAG	1 cut(s)	243
BsiHKAI	GWGCWC	1 cut(s)	136
BslI	CCNNNNNNNGG	1 cut(s)	71
BsmAI	GTCTC	1 cut(s)	54
Bso31I	GGTCTC	1 cut(s)	54
Bsp1286I	GDGCHC	1 cut(s)	136
Bsp143I	GATC	4 cut(s)	169, 204, 210, 225
BspCNI	CTCAG	1 cut(s)	242
BspHI	TCATGA	1 cut(s)	241
BspPI	GGATC	2 cut(s)	164, 233
BspTI	CTTAAG	1 cut(s)	55
BspTNI	GGTCTC	1 cut(s)	54
BssECI	CCNNGG	1 cut(s)	65
BssMI	GATC	4 cut(s)	169, 204, 210, 225
BssT1I	CCWWGG	1 cut(s)	65
BstAFI	CTTAAG	1 cut(s)	55
BstAPI	GCANNNNNTGC	1 cut(s)	119
BstDEI	CTNAG	1 cut(s)	229
BstKTI	GATC	4 cut(s)	172, 207, 213, 228
BstMAI	GTCTC	1 cut(s)	54
BstMBI	GATC	4 cut(s)	169, 204, 210, 225
BstMWI	GCNNNNNNNGC	1 cut(s)	119
BstX2I	RGATCY	2 cut(s)	169, 225
BstYI	RGATCY	2 cut(s)	169, 225
CciI	TCATGA	1 cut(s)	241
CviAII	CATG	2 cut(s)	140, 242
CviJI	RGCY	2 cut(s)	54, 181
CviKI_1	RGCY	2 cut(s)	54, 181
DdeI	CTNAG	1 cut(s)	229
DpnI	GATC	4 cut(s)	171, 206, 212, 227
DpnII	GATC	4 cut(s)	169, 204, 210, 225
Eco130I	CCWWGG	1 cut(s)	65
Eco31I	GGTCTC	1 cut(s)	54
Eco32I	GATATC	1 cut(s)	4
EcoRV	GATATC	1 cut(s)	4
EcoT14I	CCWWGG	1 cut(s)	65
ErhI	CCWWGG	1 cut(s)	65
FaeI	CATG	2 cut(s)	143, 245
FaiI	YATR	2 cut(s)	141, 243
FalI	AAGNNNNNCTT	2 cut(s)	49, 81
FatI	CATG	2 cut(s)	139, 241
FspBI	CTAG	1 cut(s)	162
Hin1II	CATG	2 cut(s)	143, 245
HincII	GTYRAC	1 cut(s)	145
HindII	GTYRAC	1 cut(s)	145
HphI	GGTGA	1 cut(s)	128
Hpy166II	GTNNAC	1 cut(s)	145
Hpy188I	TCNGA	1 cut(s)	232
Hpy188III	TCNNGA	4 cut(s)	7, 173, 208, 242
Hpy8I	GTNNAC	1 cut(s)	145
HpyAV	CCTTC	1 cut(s)	122
HpyCH4V	TGCA	1 cut(s)	122
HpyF10VI	GCNNNNNNNGC	1 cut(s)	119
HpyF3I	CTNAG	1 cut(s)	229
Hsp92II	CATG	2 cut(s)	143, 245
Kzo9I	GATC	4 cut(s)	169, 204, 210, 225
LmnI	GCTCC	1 cut(s)	30
LpnPI	CCDG	1 cut(s)	186
MaeI	CTAG	1 cut(s)	162
MalI	GATC	4 cut(s)	171, 206, 212, 227
MboI	GATC	4 cut(s)	169, 204, 210, 225
MboII	GAAGA	3 cut(s)	33, 34, 179
MfeI	CAATTG	1 cut(s)	114
MflI	RGATCY	2 cut(s)	169, 225
MhlI	GDGCHC	1 cut(s)	136
MluCI	AATT	1 cut(s)	114
MnlI	CCTC	5 cut(s)	3, 71, 96, 144, 186
MseI	TTAA	3 cut(s)	48, 56, 183
MspCI	CTTAAG	1 cut(s)	55
MunI	CAATTG	1 cut(s)	114
MwoI	GCNNNNNNNGC	1 cut(s)	119
NdeII	GATC	4 cut(s)	169, 204, 210, 225
NlaIII	CATG	2 cut(s)	143, 245
PagI	TCATGA	1 cut(s)	241
PsuI	RGATCY	2 cut(s)	169, 225
SaqAI	TTAA	3 cut(s)	48, 56, 183
Sau3AI	GATC	4 cut(s)	169, 204, 210, 225
SduI	GDGCHC	1 cut(s)	136
SetI	ASST	3 cut(s)	133, 155, 249
SmlI	CTYRAG	2 cut(s)	55, 148
SmoI	CTYRAG	2 cut(s)	55, 148
Sse9I	AATT	1 cut(s)	114
SspI	AATATT	2 cut(s)	94, 236
SspMI	CTAG	1 cut(s)	162
StyI	CCWWGG	1 cut(s)	65
TasI	AATT	1 cut(s)	114
Tru1I	TTAA	3 cut(s)	48, 56, 183
Tru9I	TTAA	3 cut(s)	48, 56, 183
Vha464I	CTTAAG	1 cut(s)	55
XspI	CTAG	1 cut(s)	162

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.