Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8333173.1

Orthogroup ID

OG0005943

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 623

Gene Structure 623 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8333173.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 270 bp

atgtcgaggatcactaagtggaagcttgagaagacaaaagtgaaggtggttttcaggctacaattcaacgctacacatattccccaaagcggatgggataagttgtttatatctttcatacctgctgattctggaaaggcaactgcaaagacaaccaaagcaaatgtgaggaatggaacatgcaaatgggcagatcctatctacgaaactacaagacttctacaagacactaaaacaaagaaatttgatgagaagctctataaacttgtg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

NT-C2

Protein Analysis

90

Amino Acids

10.45

Weight (kDa)

10.05

Isoelectric Point (pI)

28.57

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005943)

Species	Orthologous Gene IDs
rosa_laevigata	RLG00000004219 RLG00000005084 RLG00000010195 RLG00000013467 RLG00000014305 RLG00000028980 RLG00000030839 RLG00000032541
rosa_multiflora	Rmu_co8333173.1_g000001 Rmu_sc0001609.1_g000028 Rmu_sc0003426.1_g000014 Rmu_sc0010981.1_g000007 Rmu_sc0019815.1_g000001 Rmu_sc0023018.1_g000001 Rmu_ssc0000323.1_g000018
rosa_roxburghii	Rroxscaffold_1G00008410 Rroxscaffold_4G00294860 Rroxscaffold_5G00373940
rosa_samantha	Rh2BG307500 Rh2CG285600 Rh3CG238400 Rh4CG114700 Rh5DG479400 Rh5DG522500 Rh6CG228800 Rh6DG235200 Rh7AG303100 Rh7CG263200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	130
AciI	CCGC	1 cut(s)	90
AclWI	GGATC	2 cut(s)	17, 188
AcsI	RAATTY	1 cut(s)	242
AdeI	CACNNNGTG	1 cut(s)	18
AfiI	CCNNNNNNNGG	1 cut(s)	89
AgsI	TTSAA	1 cut(s)	67
AluBI	AGCT	2 cut(s)	25, 256
AluI	AGCT	2 cut(s)	25, 256
AlwI	GGATC	2 cut(s)	17, 188
ApoI	RAATTY	1 cut(s)	242
BbsI	GAAGAC	1 cut(s)	38
BccI	CCATC	1 cut(s)	87
BfuAI	ACCTGC	1 cut(s)	130
BpiI	GAAGAC	1 cut(s)	38
BpuEI	CTTGAG	1 cut(s)	47
Bsc4I	CCNNNNNNNGG	1 cut(s)	89
BseGI	GGATG	1 cut(s)	98
BseLI	CCNNNNNNNGG	1 cut(s)	89
BslI	CCNNNNNNNGG	1 cut(s)	89
Bsp143I	GATC	2 cut(s)	9, 193
BspACI	CCGC	1 cut(s)	90
BspMI	ACCTGC	1 cut(s)	130
BspPI	GGATC	2 cut(s)	17, 188
BssMI	GATC	2 cut(s)	9, 193
BstDEI	CTNAG	1 cut(s)	15
BstF5I	GGATG	1 cut(s)	98
BstKTI	GATC	2 cut(s)	12, 196
BstMBI	GATC	2 cut(s)	9, 193
BstNSI	RCATGY	1 cut(s)	183
BstV2I	GAAGAC	1 cut(s)	38
BstX2I	RGATCY	1 cut(s)	193
BstYI	RGATCY	1 cut(s)	193
BtsCI	GGATG	1 cut(s)	98
BveI	ACCTGC	1 cut(s)	130
CviAII	CATG	1 cut(s)	180
CviJI	RGCY	3 cut(s)	25, 58, 256
CviKI_1	RGCY	3 cut(s)	25, 58, 256
DdeI	CTNAG	1 cut(s)	15
DpnI	GATC	2 cut(s)	11, 195
DpnII	GATC	2 cut(s)	9, 193
DraIII	CACNNNGTG	1 cut(s)	18
FaeI	CATG	1 cut(s)	183
FaiI	YATR	5 cut(s)	78, 110, 119, 181, 261
FatI	CATG	1 cut(s)	179
FokI	GGATG	1 cut(s)	105
Hin1II	CATG	1 cut(s)	183
HindIII	AAGCTT	1 cut(s)	23
HinfI	GANTC	1 cut(s)	128
Hpy188III	TCNNGA	1 cut(s)	132
HpyAV	CCTTC	1 cut(s)	37
HpyCH4V	TGCA	2 cut(s)	146, 183
HpyF3I	CTNAG	1 cut(s)	15
Hsp92II	CATG	1 cut(s)	183
Kzo9I	GATC	2 cut(s)	9, 193
LpnPI	CCDG	3 cut(s)	40, 117, 135
MalI	GATC	2 cut(s)	11, 195
MboI	GATC	2 cut(s)	9, 193
MboII	GAAGA	1 cut(s)	43
MflI	RGATCY	1 cut(s)	193
MluCI	AATT	2 cut(s)	62, 242
MnlI	CCTC	1 cut(s)	162
MslI	CAYNNNNRTG	1 cut(s)	184
NdeII	GATC	2 cut(s)	9, 193
NlaIII	CATG	1 cut(s)	183
NspI	RCATGY	1 cut(s)	183
PfeI	GAWTC	1 cut(s)	128
PsuI	RGATCY	1 cut(s)	193
RseI	CAYNNNNRTG	1 cut(s)	184
Sau3AI	GATC	2 cut(s)	9, 193
SetI	ASST	4 cut(s)	27, 48, 124, 258
SgeI	CNNG	8 cut(s)	18, 38, 67, 134, 144, 192, 225, 236
SmiMI	CAYNNNNRTG	1 cut(s)	184
SmlI	CTYRAG	1 cut(s)	26
SmoI	CTYRAG	1 cut(s)	26
Sse9I	AATT	2 cut(s)	62, 242
SsiI	CCGC	1 cut(s)	90
TaqI	TCGA	1 cut(s)	5
TasI	AATT	2 cut(s)	62, 242
TfiI	GAWTC	1 cut(s)	128
TspDTI	ATGAA	1 cut(s)	106
XapI	RAATTY	1 cut(s)	242
XceI	RCATGY	1 cut(s)	183

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.