Rroxscaffold_4G00294860

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0005943
Physical Location & Seq
Reverse (-)
14807542 .. 14808475
934 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00294860.1

Sequence Viewer

Length: 204 bp
ATGTCCAATAGGATTTCCAGACGTGCTTCACAAGTAGTCAAGACCTTCTGCCGGAAGGGGTCCAACCTTGATGTTTACCATGGTCGGGGCGCGGCGGACGTCGGTGATGGTAGCGGCCAAGTGCCGAGGCTAAATCTAAGCCCAATTGATGGGCTTGAAGTGGTGCAATCCCTAGACTGTGGAAGATCTGGTTTTGGGACCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.09

Weight (kDa)

9.38

Isoelectric Point (pI)

42.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 102
AccB7I CCANNNNNTGG 1 cut(s) 149
AccII CGCG 1 cut(s) 92
AciI CCGC 3 cut(s) 92, 95, 114
AcoI YGGCCR 1 cut(s) 115
AcyI GRCGYC 1 cut(s) 99
AfiI CCNNNNNNNGG 3 cut(s) 51, 85, 149
AgsI TTSAA 1 cut(s) 158
AjiI CACGTC 1 cut(s) 23
AoxI GGCC 1 cut(s) 115
AspLEI GCGC 1 cut(s) 92
AspS9I GGNCC 2 cut(s) 60, 198
AsuHPI GGTGA 1 cut(s) 116
AvaII GGWCC 2 cut(s) 60, 198
BccI CCATC 2 cut(s) 101, 143
BfaI CTAG 2 cut(s) 173, 202
BglII AGATCT 1 cut(s) 185
BisI GCNGC 2 cut(s) 93, 115
BlsI GCNGC 2 cut(s) 94, 116
Bme18I GGWCC 2 cut(s) 60, 198
BmgBI CACGTC 1 cut(s) 23
BmgT120I GGNCC 2 cut(s) 60, 198
BmiI GGNNCC 2 cut(s) 61, 199
BsaHI GRCGYC 1 cut(s) 99
BsaJI CCNNGG 2 cut(s) 79, 125
Bsc4I CCNNNNNNNGG 3 cut(s) 51, 85, 149
BseDI CCNNGG 2 cut(s) 79, 125
BseLI CCNNNNNNNGG 3 cut(s) 51, 85, 149
Bsh1236I CGCG 1 cut(s) 92
BshFI GGCC 1 cut(s) 117
BsiSI CCGG 1 cut(s) 52
BslI CCNNNNNNNGG 3 cut(s) 51, 85, 149
BsnI GGCC 1 cut(s) 117
Bsp143I GATC 1 cut(s) 185
Bsp19I CCATGG 1 cut(s) 79
BspACI CCGC 3 cut(s) 92, 95, 114
BspANI GGCC 1 cut(s) 117
BspFNI CGCG 1 cut(s) 92
BspLI GGNNCC 2 cut(s) 61, 199
BssECI CCNNGG 2 cut(s) 79, 125
BssMI GATC 1 cut(s) 185
BssNI GRCGYC 1 cut(s) 99
BssT1I CCWWGG 1 cut(s) 79
Bst4CI ACNGT 1 cut(s) 179
BstACI GRCGYC 1 cut(s) 99
BstDEI CTNAG 1 cut(s) 137
BstDSI CCRYGG 1 cut(s) 79
BstFNI CGCG 1 cut(s) 92
BstHHI GCGC 1 cut(s) 92
BstKTI GATC 1 cut(s) 188
BstMBI GATC 1 cut(s) 185
BstUI CGCG 1 cut(s) 92
BstX2I RGATCY 1 cut(s) 185
BstYI RGATCY 1 cut(s) 185
BsuRI GGCC 1 cut(s) 117
BtgI CCRYGG 1 cut(s) 79
BtrI CACGTC 1 cut(s) 23
CfoI GCGC 1 cut(s) 92
Cfr13I GGNCC 2 cut(s) 60, 198
CviAII CATG 1 cut(s) 80
CviJI RGCY 4 cut(s) 117, 130, 141, 154
CviKI_1 RGCY 4 cut(s) 117, 130, 141, 154
DdeI CTNAG 1 cut(s) 137
DpnI GATC 1 cut(s) 187
DpnII GATC 1 cut(s) 185
EaeI YGGCCR 1 cut(s) 115
EciI GGCGGA 1 cut(s) 110
Eco130I CCWWGG 1 cut(s) 79
Eco47I GGWCC 2 cut(s) 60, 198
EcoO109I RGGNCCY 1 cut(s) 198
EcoT14I CCWWGG 1 cut(s) 79
ErhI CCWWGG 1 cut(s) 79
FaeI CATG 1 cut(s) 83
FaiI YATR 1 cut(s) 81
FatI CATG 1 cut(s) 79
Fnu4HI GCNGC 2 cut(s) 93, 115
Fsp4HI GCNGC 2 cut(s) 93, 115
FspBI CTAG 2 cut(s) 173, 202
GlaI GCGC 1 cut(s) 91
GluI GCNGC 2 cut(s) 93, 115
HaeIII GGCC 1 cut(s) 117
HapII CCGG 1 cut(s) 52
HhaI GCGC 1 cut(s) 92
Hin1I GRCGYC 1 cut(s) 99
Hin1II CATG 1 cut(s) 83
Hin6I GCGC 1 cut(s) 90
HinP1I GCGC 1 cut(s) 90
HpaII CCGG 1 cut(s) 52
HphI GGTGA 1 cut(s) 116
Hpy166II GTNNAC 1 cut(s) 76
Hpy188III TCNNGA 2 cut(s) 18, 40
Hpy8I GTNNAC 1 cut(s) 76
Hpy99I CGWCG 1 cut(s) 104
HpyAV CCTTC 2 cut(s) 49, 55
HpyCH4III ACNGT 1 cut(s) 179
HpyCH4IV ACGT 2 cut(s) 22, 99
HpyCH4V TGCA 1 cut(s) 166
HpyF3I CTNAG 1 cut(s) 137
HpySE526I ACGT 2 cut(s) 22, 99
Hsp92I GRCGYC 1 cut(s) 99
Hsp92II CATG 1 cut(s) 83
HspAI GCGC 1 cut(s) 90
Kzo9I GATC 1 cut(s) 185
LpnPI CCDG 3 cut(s) 31, 65, 174
MaeI CTAG 2 cut(s) 173, 202
MaeII ACGT 2 cut(s) 22, 99
MalI GATC 1 cut(s) 187
MboI GATC 1 cut(s) 185
MboII GAAGA 1 cut(s) 195
MfeI CAATTG 1 cut(s) 144
MflI RGATCY 1 cut(s) 185
MluCI AATT 1 cut(s) 144
MmeI TCCRAC 1 cut(s) 87
MnlI CCTC 1 cut(s) 120
MspI CCGG 1 cut(s) 52
MunI CAATTG 1 cut(s) 144
MvnI CGCG 1 cut(s) 92
NcoI CCATGG 1 cut(s) 79
NdeII GATC 1 cut(s) 185
NlaIII CATG 1 cut(s) 83
NlaIV GGNNCC 2 cut(s) 61, 199
NmeAIII GCCGAG 1 cut(s) 150
PflMI CCANNNNNTGG 1 cut(s) 149
PkrI GCNGC 2 cut(s) 94, 116
PpuMI RGGWCCY 1 cut(s) 198
Psp5II RGGWCCY 1 cut(s) 198
PspN4I GGNNCC 2 cut(s) 61, 199
PspPI GGNCC 2 cut(s) 60, 198
PspPPI RGGWCCY 1 cut(s) 198
PsuI RGATCY 1 cut(s) 185
SatI GCNGC 2 cut(s) 93, 115
Sau3AI GATC 1 cut(s) 185
Sau96I GGNCC 2 cut(s) 60, 198
SetI ASST 5 cut(s) 25, 47, 69, 102, 203
SinI GGWCC 2 cut(s) 60, 198
Sse9I AATT 1 cut(s) 144
SsiI CCGC 3 cut(s) 92, 95, 114
SspMI CTAG 2 cut(s) 173, 202
StyI CCWWGG 1 cut(s) 79
TaaI ACNGT 1 cut(s) 179
TaiI ACGT 2 cut(s) 25, 102
TasI AATT 1 cut(s) 144
TauI GCSGC 2 cut(s) 95, 117
Van91I CCANNNNNTGG 1 cut(s) 149
VpaK11BI GGWCC 2 cut(s) 60, 198
XspI CTAG 2 cut(s) 173, 202
ZraI GACGTC 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.