Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8408683.1

Orthogroup ID

OG0003407

Physical Location & Seq

Genomic Coordinates Reverse (-)

861 .. 1297

Gene Structure 437 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8408683.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 339 bp

atgaaaaaagactgtcagaggagaaggcctggggtggaagttgaggtagcattgcttgaagggaacgaaggaggtgcaataattgtggaagaagcaaagaaacaaaaggtatctctacttgttcttggccaaaaaagagagaggtcaatgtggtggaagctaatcaacaagtgctggacgagtaggcgaaggagaagaacatccagaagcggtgaggttgtggaatactgcatacaaaatgctggatgcatgacgattgcggtgaggagaaagagcagaagacttggaggctacttgatcaccaccaagcttcacaagaatttctggcttctagcttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Usp

Protein Analysis

112

Amino Acids

13.06

Weight (kDa)

10.62

Isoelectric Point (pI)

76.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003407)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G03720 AT2G03720
fragaria_vesca	FvH4_4g29580 FvH4_5g13480
malus_domestica	MD06G1204700.v1.1 MD13G1059000.v1.1 MD14G1215800.v1.1 MD16G1058300.v1.1
prunus_persica	Prupe.1G290800_v2.0.a1 Prupe.1G290800_v2.0.a1 Prupe.5G208600_v2.0.a1
pyrus_communis	pycom06g18280 pycom13g05250 pycom14g17860 pycom16g05100
rosa_chinensis	RchiOBHm_Chr4g0437821 RchiOBHm_Chr7g0183591
rosa_laevigata	RLG00000005039 RLG00000006410
rosa_multiflora	Rmu_co8408683.1_g000001 Rmu_sc0003610.1_g000018 Rmu_sc0004193.1_g000014
rosa_roxburghii	Rroxscaffold_3G00270380 Rroxscaffold_5G00378990
rosa_rugosa	Rorug04G0303800 Rorug06G0458700
rosa_samantha	Rh4AG356200 Rh4BG367000 Rh4CG380900 Rh4DG361400 Rh7AG059800 Rh7BG059500 Rh7CG061500 Rh7DG059900
rosa_wichuraiana	Rw4G031420 Rw7G004910

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	210, 260
AcoI	YGGCCR	1 cut(s)	127
AcsI	RAATTY	1 cut(s)	319
AgsI	TTSAA	1 cut(s)	59
AjnI	CCWGG	1 cut(s)	28
AluBI	AGCT	3 cut(s)	160, 310, 335
AluI	AGCT	3 cut(s)	160, 310, 335
AoxI	GGCC	2 cut(s)	26, 127
ApoI	RAATTY	1 cut(s)	319
AsuHPI	GGTGA	3 cut(s)	224, 274, 292
BalI	TGGCCA	1 cut(s)	129
BbsI	GAAGAC	1 cut(s)	286
BcgI	CGANNNNNNTGC	2 cut(s)	56, 90
BciT130I	CCWGG	1 cut(s)	30
BclI	TGATCA	1 cut(s)	297
BfaI	CTAG	1 cut(s)	332
Bme1390I	CCNGG	1 cut(s)	30
BmrFI	CCNGG	1 cut(s)	30
BmsI	GCATC	1 cut(s)	236
BpiI	GAAGAC	1 cut(s)	286
BsaJI	CCNNGG	1 cut(s)	29
Bse3DI	GCAATG	1 cut(s)	50
BseBI	CCWGG	1 cut(s)	30
BseDI	CCNNGG	1 cut(s)	29
BseGI	GGATG	2 cut(s)	200, 251
BseMI	GCAATG	1 cut(s)	50
BseRI	GAGGAG	2 cut(s)	34, 280
BshFI	GGCC	2 cut(s)	28, 129
BsnI	GGCC	2 cut(s)	28, 129
Bsp143I	GATC	1 cut(s)	297
BspACI	CCGC	2 cut(s)	210, 260
BspANI	GGCC	2 cut(s)	28, 129
BsrDI	GCAATG	1 cut(s)	50
BssECI	CCNNGG	1 cut(s)	29
BssMI	GATC	1 cut(s)	297
Bst2UI	CCWGG	1 cut(s)	30
Bst4CI	ACNGT	1 cut(s)	14
BstF5I	GGATG	2 cut(s)	200, 251
BstKTI	GATC	1 cut(s)	300
BstMBI	GATC	1 cut(s)	297
BstNI	CCWGG	1 cut(s)	30
BstSCI	CCNGG	1 cut(s)	28
BstV2I	GAAGAC	1 cut(s)	286
BsuRI	GGCC	2 cut(s)	28, 129
BtsCI	GGATG	2 cut(s)	200, 251
CspCI	CAANNNNNGTGG	2 cut(s)	66, 101
CviAII	CATG	1 cut(s)	250
CviJI	RGCY	7 cut(s)	28, 129, 160, 291, 310, 328, 335
CviKI_1	RGCY	7 cut(s)	28, 129, 160, 291, 310, 328, 335
DpnI	GATC	1 cut(s)	299
DpnII	GATC	1 cut(s)	297
EaeI	YGGCCR	1 cut(s)	127
Eco147I	AGGCCT	1 cut(s)	28
EcoRII	CCWGG	1 cut(s)	28
EcoT22I	ATGCAT	1 cut(s)	251
FaeI	CATG	1 cut(s)	253
FaiI	YATR	2 cut(s)	233, 251
FatI	CATG	1 cut(s)	249
FbaI	TGATCA	1 cut(s)	297
FokI	GGATG	2 cut(s)	187, 258
FspBI	CTAG	1 cut(s)	332
HaeIII	GGCC	2 cut(s)	28, 129
Hin1II	CATG	1 cut(s)	253
HindIII	AAGCTT	1 cut(s)	308
HphI	GGTGA	3 cut(s)	224, 274, 292
Hpy188I	TCNGA	1 cut(s)	18
Hpy188III	TCNNGA	1 cut(s)	204
HpyAV	CCTTC	4 cut(s)	18, 53, 62, 183
HpyCH4III	ACNGT	1 cut(s)	14
HpyCH4V	TGCA	3 cut(s)	77, 231, 249
Hsp92II	CATG	1 cut(s)	253
Ksp22I	TGATCA	1 cut(s)	297
Kzo9I	GATC	1 cut(s)	297
LpnPI	CCDG	6 cut(s)	15, 42, 160, 217, 228, 310
LweI	GCATC	1 cut(s)	236
MaeI	CTAG	1 cut(s)	332
MalI	GATC	1 cut(s)	299
MboI	GATC	1 cut(s)	297
MboII	GAAGA	3 cut(s)	101, 207, 291
MlsI	TGGCCA	1 cut(s)	129
MluCI	AATT	2 cut(s)	81, 319
MluNI	TGGCCA	1 cut(s)	129
MnlI	CCTC	7 cut(s)	12, 37, 65, 135, 208, 258, 281
Mox20I	TGGCCA	1 cut(s)	129
Mph1103I	ATGCAT	1 cut(s)	251
MscI	TGGCCA	1 cut(s)	129
MseI	TTAA	1 cut(s)	337
Msp20I	TGGCCA	1 cut(s)	129
MspR9I	CCNGG	1 cut(s)	30
MvaI	CCWGG	1 cut(s)	30
NdeII	GATC	1 cut(s)	297
NlaIII	CATG	1 cut(s)	253
NsiI	ATGCAT	1 cut(s)	251
PceI	AGGCCT	1 cut(s)	28
Psp6I	CCWGG	1 cut(s)	28
PspGI	CCWGG	1 cut(s)	28
SaqAI	TTAA	1 cut(s)	337
Sau3AI	GATC	1 cut(s)	297
ScrFI	CCNGG	1 cut(s)	30
SetI	ASST	8 cut(s)	48, 76, 111, 146, 162, 219, 312, 337
SfaNI	GCATC	1 cut(s)	236
Sse9I	AATT	2 cut(s)	81, 319
SseBI	AGGCCT	1 cut(s)	28
SsiI	CCGC	2 cut(s)	210, 260
SspMI	CTAG	1 cut(s)	332
StuI	AGGCCT	1 cut(s)	28
StyD4I	CCNGG	1 cut(s)	28
TaaI	ACNGT	1 cut(s)	14
TasI	AATT	2 cut(s)	81, 319
Tru1I	TTAA	1 cut(s)	337
Tru9I	TTAA	1 cut(s)	337
TspDTI	ATGAA	1 cut(s)	17
XapI	RAATTY	1 cut(s)	319
XspI	CTAG	1 cut(s)	332
Zsp2I	ATGCAT	1 cut(s)	251

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.