Rmu_co8466533.1_g000001

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8466533.1
Physical Location & Seq
Forward (+)
390 .. 945
556 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8466533.1_g000001.1.cds

Sequence Viewer

Length: 444 bp
atgttccttaccattgtgatggtaattgctagtggattcttgttcatctcatatggctttcgaaacttgacggaggctctagctattgtgttcacacttcccgcatcatttggtatcagagcgggtatcgcctgctccttagcagacgacgatctaagggagaaattcattatcgccaacctcaacgacggtagtatagaattaccattaacgctgaagagctacgaccttccgtccttcattgttgctacgaatccgtacaacggagctgtccaattgttcggcgaacagttcgagaagcttagacaagaaagcaggccaatcatactagcgaacacgtttgatgcactagagcctgaggcgttcaaagcattagacaagtataacttgatcggaatcggacctttaatgccatcagctttcttagactgcaaggacccgtag

Protein Analysis

147

Amino Acids

16.17

Weight (kDa)

4.53

Isoelectric Point (pI)

34.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000585)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G15550
fragaria_vesca FvH4_4g13000 FvH4_4g13010 FvH4_4g13020
malus_domestica MD04G1019300.v1.1 MD04G1019400.v1.1 MD04G1019500.v1.1 MD04G1019600.v1.1 MD04G1019700.v1.1
prunus_persica Prupe.1G169100_v2.0.a1 Prupe.1G169200_v2.0.a1 Prupe.1G169300_v2.0.a1
pyrus_communis pycom04g01550 pycom04g01560 pycom04g01580 pycom12g16570
rosa_chinensis RchiOBHm_Chr4g0412431 RchiOBHm_Chr4g0412441 RchiOBHm_Chr4g0412481 RchiOBHm_Chr4g0412491 RchiOBHm_Chr4g0412501 RchiOBHm_Chr4g0412731 RchiOBHm_Chr4g0412741
rosa_laevigata RLG00000008262 RLG00000008264 RLG00000008266 RLG00000008267 RLG00000008285 RLG00000008286 RLG00000008299 RLG00000008300
rosa_multiflora Rmu_co8207190.1_g000001 Rmu_co8436959.1_g000001 Rmu_co8466533.1_g000001 Rmu_sc0001238.1_g000017 Rmu_sc0001238.1_g000019 Rmu_sc0001238.1_g000022 Rmu_sc0001238.1_g000027 Rmu_sc0001238.1_g000036 Rmu_sc0003914.1_g000013 Rmu_sc0005615.1_g000006 Rmu_sc0008191.1_g000017
rosa_roxburghii Rroxscaffold_161G00448030 Rroxscaffold_161G00448050 Rroxscaffold_5G00356580 Rroxscaffold_5G00356640 Rroxscaffold_5G00356700 Rroxscaffold_5G00356890 Rroxscaffold_5G00356930 Rroxscaffold_5G00356960
rosa_rugosa Rorug04G0103500 Rorug04G0103600.1 Rorug04G0103800.1 Rorug04G0103900.1 Rorug04G0116000 Rorug04G0116000 Rorug04G0116000 Rorug04G0116300
rosa_samantha Rh4AG173100 Rh4AG173400 Rh4AG175100 Rh4AG175200 Rh4BG172800 Rh4BG174400 Rh4BG174700 Rh4BG174800 Rh4CG183800 Rh4CG183900 Rh4CG184400 Rh4CG186100 Rh4DG168100 Rh4DG168800 Rh4DG171000 Rh4DG171200 Rh4DG171800 Rh4DG171900
rosa_wichuraiana Rw0G007780 Rw4G014480 Rw4G014670 Rw4G014680 Rw4G014700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 122
AciI CCGC 2 cut(s) 102, 122
AcsI RAATTY 1 cut(s) 164
AcuI CTGAAG 1 cut(s) 236
AfaI GTAC 1 cut(s) 260
AfiI CCNNNNNNNGG 1 cut(s) 263
AflIII ACRYGT 1 cut(s) 336
AgsI TTSAA 1 cut(s) 367
AhdI GACNNNNNGTC 1 cut(s) 232
AluBI AGCT 5 cut(s) 83, 222, 269, 301, 419
AluI AGCT 5 cut(s) 83, 222, 269, 301, 419
AoxI GGCC 1 cut(s) 317
ApoI RAATTY 1 cut(s) 164
AspS9I GGNCC 2 cut(s) 401, 436
AsuII TTCGAA 1 cut(s) 61
AvaII GGWCC 2 cut(s) 401, 436
AxyI CCTNAGG 1 cut(s) 357
BccI CCATC 2 cut(s) 13, 421
BfaI CTAG 4 cut(s) 30, 80, 329, 350
Bme18I GGWCC 2 cut(s) 401, 436
BmeRI GACNNNNNGTC 1 cut(s) 232
BmgT120I GGNCC 2 cut(s) 401, 436
BmiI GGNNCC 1 cut(s) 438
BmsI GCATC 2 cut(s) 113, 334
Bpu10I CCTNAGC 1 cut(s) 139
Bpu14I TTCGAA 1 cut(s) 61
BsaBI GATNNNNATC 1 cut(s) 395
Bsc4I CCNNNNNNNGG 1 cut(s) 263
Bse21I CCTNAGG 1 cut(s) 357
Bse8I GATNNNNATC 1 cut(s) 395
BseJI GATNNNNATC 1 cut(s) 395
BseLI CCNNNNNNNGG 1 cut(s) 263
BseMII CTCAG 1 cut(s) 348
BshFI GGCC 1 cut(s) 319
BslI CCNNNNNNNGG 1 cut(s) 263
BsnI GGCC 1 cut(s) 319
Bsp119I TTCGAA 1 cut(s) 61
Bsp143I GATC 2 cut(s) 151, 390
BspACI CCGC 2 cut(s) 102, 122
BspANI GGCC 1 cut(s) 319
BspCNI CTCAG 1 cut(s) 349
BspLI GGNNCC 1 cut(s) 438
BspQI GCTCTTC 1 cut(s) 212
BspT104I TTCGAA 1 cut(s) 61
BsrBI CCGCTC 1 cut(s) 122
BssMI GATC 2 cut(s) 151, 390
Bst4CI ACNGT 2 cut(s) 191, 291
Bst6I CTCTTC 1 cut(s) 212
BstBI TTCGAA 1 cut(s) 61
BstC8I GCNNGC 2 cut(s) 133, 317
BstDEI CTNAG 5 cut(s) 139, 155, 302, 357, 424
BstKTI GATC 2 cut(s) 154, 393
BstMBI GATC 2 cut(s) 151, 390
BstMWI GCNNNNNNNGC 2 cut(s) 128, 368
BstXI CCANNNNNNTGG 1 cut(s) 19
Bsu36I CCTNAGG 1 cut(s) 357
BsuRI GGCC 1 cut(s) 319
Cac8I GCNNGC 2 cut(s) 133, 317
Cfr13I GGNCC 2 cut(s) 401, 436
Csp6I GTAC 1 cut(s) 259
CviJI RGCY 9 cut(s) 57, 77, 83, 222, 269, 301, 319, 355, 419
CviKI_1 RGCY 9 cut(s) 57, 77, 83, 222, 269, 301, 319, 355, 419
CviQI GTAC 1 cut(s) 259
DdeI CTNAG 5 cut(s) 139, 155, 302, 357, 424
DpnI GATC 2 cut(s) 153, 392
DpnII GATC 2 cut(s) 151, 390
DriI GACNNNNNGTC 1 cut(s) 232
Eam1104I CTCTTC 1 cut(s) 212
Eam1105I GACNNNNNGTC 1 cut(s) 232
EarI CTCTTC 1 cut(s) 212
Eco47I GGWCC 2 cut(s) 401, 436
Eco57I CTGAAG 1 cut(s) 236
Eco81I CCTNAGG 1 cut(s) 357
EcoO109I RGGNCCY 1 cut(s) 436
FaiI YATR 5 cut(s) 52, 54, 197, 326, 384
FalI AAGNNNNNCTT 2 cut(s) 371, 403
FauI CCCGC 2 cut(s) 109, 115
FauNDI CATATG 1 cut(s) 52
FspBI CTAG 4 cut(s) 30, 80, 329, 350
HaeIII GGCC 1 cut(s) 319
HindIII AAGCTT 1 cut(s) 299
HinfI GANTC 3 cut(s) 36, 253, 396
Hpy166II GTNNAC 1 cut(s) 93
Hpy188I TCNGA 3 cut(s) 119, 395, 401
Hpy188III TCNNGA 1 cut(s) 295
Hpy8I GTNNAC 1 cut(s) 93
Hpy99I CGWCG 2 cut(s) 152, 191
HpyAV CCTTC 2 cut(s) 239, 247
HpyCH4III ACNGT 2 cut(s) 191, 291
HpyCH4IV ACGT 1 cut(s) 338
HpyCH4V TGCA 2 cut(s) 347, 432
HpyF10VI GCNNNNNNNGC 2 cut(s) 128, 368
HpyF3I CTNAG 5 cut(s) 139, 155, 302, 357, 424
HpySE526I ACGT 1 cut(s) 338
Kzo9I GATC 2 cut(s) 151, 390
LguI GCTCTTC 1 cut(s) 212
LmnI GCTCC 2 cut(s) 140, 266
LpnPI CCDG 3 cut(s) 145, 301, 369
LweI GCATC 2 cut(s) 113, 334
MaeI CTAG 4 cut(s) 30, 80, 329, 350
MaeII ACGT 1 cut(s) 338
MalI GATC 2 cut(s) 153, 392
MbiI CCGCTC 1 cut(s) 122
MboI GATC 2 cut(s) 151, 390
MboII GAAGA 1 cut(s) 229
MfeI CAATTG 1 cut(s) 275
MluCI AATT 4 cut(s) 24, 164, 200, 275
MnlI CCTC 3 cut(s) 67, 191, 352
MseI TTAA 2 cut(s) 209, 407
MslI CAYNNNNRTG 1 cut(s) 17
MunI CAATTG 1 cut(s) 275
MwoI GCNNNNNNNGC 2 cut(s) 128, 368
NdeI CATATG 1 cut(s) 52
NdeII GATC 2 cut(s) 151, 390
NlaIV GGNNCC 1 cut(s) 438
NspV TTCGAA 1 cut(s) 61
PciSI GCTCTTC 1 cut(s) 212
PfeI GAWTC 3 cut(s) 36, 253, 396
PpuMI RGGWCCY 1 cut(s) 436
Psp5II RGGWCCY 1 cut(s) 436
PspN4I GGNNCC 1 cut(s) 438
PspPI GGNCC 2 cut(s) 401, 436
PspPPI RGGWCCY 1 cut(s) 436
RsaI GTAC 1 cut(s) 260
RsaNI GTAC 1 cut(s) 259
RseI CAYNNNNRTG 1 cut(s) 17
SapI GCTCTTC 1 cut(s) 212
SaqAI TTAA 2 cut(s) 209, 407
Sau3AI GATC 2 cut(s) 151, 390
Sau96I GGNCC 2 cut(s) 401, 436
SetI ASST 9 cut(s) 85, 183, 224, 231, 271, 303, 341, 406, 421
SfaNI GCATC 2 cut(s) 113, 334
SfuI TTCGAA 1 cut(s) 61
SinI GGWCC 2 cut(s) 401, 436
SmiMI CAYNNNNRTG 1 cut(s) 17
Sse9I AATT 4 cut(s) 24, 164, 200, 275
SsiI CCGC 2 cut(s) 102, 122
SspMI CTAG 4 cut(s) 30, 80, 329, 350
TaaI ACNGT 2 cut(s) 191, 291
TaiI ACGT 1 cut(s) 341
TaqI TCGA 2 cut(s) 61, 294
TasI AATT 4 cut(s) 24, 164, 200, 275
TfiI GAWTC 3 cut(s) 36, 253, 396
Tru1I TTAA 2 cut(s) 209, 407
Tru9I TTAA 2 cut(s) 209, 407
TspDTI ATGAA 3 cut(s) 34, 157, 229
TspGWI ACGGA 4 cut(s) 86, 222, 246, 279
VpaK11BI GGWCC 2 cut(s) 401, 436
XapI RAATTY 1 cut(s) 164
XspI CTAG 4 cut(s) 30, 80, 329, 350
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.